GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2026-09-29 00:40:57, GGRNA.v2 : RefSeq release 233 (Jan, 2026)

LOCUS       XR_776269                576 bp    RNA     linear   ROD 23-APR-2020
DEFINITION  PREDICTED: Fukomys damarensis uncharacterized LOC104847975
            (LOC104847975), ncRNA.
ACCESSION   XR_776269
VERSION     XR_776269.2
DBLINK      BioProject: PRJNA625221
KEYWORDS    RefSeq.
SOURCE      Fukomys damarensis (Damara mole-rat)
  ORGANISM  Fukomys damarensis
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia;
            Hystricomorpha; Bathyergidae; Fukomys.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_022900913.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Apr 23, 2020 this sequence version replaced XR_776269.1.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Fukomys damarensis Annotation
                                           Release 102
            Annotation Version          :: 102
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.4
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..576
                     /organism="Fukomys damarensis"
                     /mol_type="transcribed RNA"
                     /isolate="Sample0158"
                     /db_xref="taxon:885580"
                     /chromosome="Unknown"
                     /sex="female"
                     /tissue_type="blood from cranial vena cava"
                     /geo_loc_name="USA: Houston Zoo, Houston, TX"
                     /collection_date="05-Sep-2016"
                     /collected_by="Joseph P. Flanagan, Kelcie Pletch,
                     Christine Molter, Maryanne Tocidlowski, Lauren Howard,
                     Judilee Marrow, Andrea Lee, Jess Jimerson, Katie Plaeger,
                     Erin Neer"
     gene            1..576
                     /gene="LOC104847975"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 100% coverage of the annotated
                     genomic feature by RNAseq alignments, including 2 samples
                     with support for all annotated introns"
                     /db_xref="GeneID:104847975"
     ncRNA           1..576
                     /ncRNA_class="lncRNA"
                     /gene="LOC104847975"
                     /product="uncharacterized LOC104847975"
                     /db_xref="GeneID:104847975"
ORIGIN      
ctggtgaatggaggctgacttcttgctctccaagaactgcaagtagctacccaatctcttcttgaaatcagcagtctgtgagctcactgtagtggggcagccagaaccttaaagcctaacaatgggacagtgacaagaagagaggtggagagaaactttcacagtccccctcttccactccaagagaagaaacacacggctttattatggtaccaagtccacctccagatagaagcaatacatctcctcttgaacaagactgtttctccagtttaagcaaatctatccaaactacctccaagctgcagtgaatcatacggtggctgaaggaactacactaagaaggacttgaaagactttttgtgaaattgtagctgaaaacacaccaaatgtatgtgatgcaaagagtgcttccgaggagataaaactggtaacgaaatcttttttaagaaaaggaaaaaaggagaaaaggaaccagcaaaaatggactgaagttgatctttcaaatgggcccacagcagcgcacagcaccacctccatcatcaccatcctcctccatccccgatattcccaaga
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]