ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2026-09-29 00:40:09, GGRNA.v2 : RefSeq release 233 (Jan, 2026)
LOCUS XR_006899862 343 bp RNA linear INV 14-FEB-2022
DEFINITION PREDICTED: Haliotis rubra uncharacterized LOC124281168
(LOC124281168), ncRNA.
ACCESSION XR_006899862
VERSION XR_006899862.1
DBLINK BioProject: PRJNA801670
KEYWORDS RefSeq.
SOURCE Haliotis rubra (blacklip abalone)
ORGANISM Haliotis rubra
Eukaryota; Metazoa; Spiralia; Lophotrochozoa; Mollusca; Gastropoda;
Vetigastropoda; Lepetellida; Haliotoidea; Haliotidae; Haliotis.
COMMENT MODEL REFSEQ: This record is predicted by automated computational
analysis. This record is derived from a genomic sequence
(NW_025766891) annotated using gene prediction method: Gnomon.
Also see:
Documentation of NCBI's Annotation Process
##Genome-Annotation-Data-START##
Annotation Provider :: NCBI
Annotation Status :: Full annotation
Annotation Name :: Haliotis rubra Annotation Release
100
Annotation Version :: 100
Annotation Pipeline :: NCBI eukaryotic genome annotation
pipeline
Annotation Software Version :: 9.0
Annotation Method :: Best-placed RefSeq; Gnomon
Features Annotated :: Gene; mRNA; CDS; ncRNA
##Genome-Annotation-Data-END##
FEATURES Location/Qualifiers
source 1..343
/organism="Haliotis rubra"
/mol_type="transcribed RNA"
/isolate="DU_JTF1"
/isolation_source="Aquaculture farm"
/db_xref="taxon:36100"
/chromosome="Unknown"
/tissue_type="muscle"
/dev_stage="adult"
/geo_loc_name="Australia: Jade Tiger Abalone Farm,
Indented Head, Victoria"
/collection_date="2017"
/collected_by="Adam Miller"
gene 1..343
/gene="LOC124281168"
/note="Derived by automated computational analysis using
gene prediction method: Gnomon. Supporting evidence
includes similarity to: 100% coverage of the annotated
genomic feature by RNAseq alignments, including 10 samples
with support for all annotated introns"
/db_xref="GeneID:124281168"
ncRNA 1..343
/ncRNA_class="lncRNA"
/gene="LOC124281168"
/product="uncharacterized LOC124281168"
/db_xref="GeneID:124281168"
ORIGIN
gtgcacatcaaggttttgaccaattctgcagaagacttgaaacgcttggcgtattaggagcgctaaaacatcatggaacacgcatgaaagaagtttttgtatatgaaaaaaggcttctggattctacaacaatagaactattgttcgagccagatttagcagaggccaactccaaccgacgccgccaagaagagattgttctctcaaactggagagattttcttcttgatttggaagaaggtacggaagtccccacactcaaagacctcttggtgtttgtgaccggggctgacggaatcccgcctctgggattcgacccctctccacacctgctgtttcactc
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]