ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2026-09-29 00:40:44, GGRNA.v2 : RefSeq release 233 (Jan, 2026)
LOCUS XM_066825029 3114 bp mRNA linear PLN 31-JUL-2024 DEFINITION Apiospora marii argonaute (PG985_005260), partial mRNA. ACCESSION XM_066825029 VERSION XM_066825029.1 DBLINK BioProject: PRJNA1140273 BioSample: SAMN32718006 KEYWORDS RefSeq. SOURCE Apiospora marii ORGANISM Apiospora marii Eukaryota; Fungi; Dikarya; Ascomycota; Pezizomycotina; Sordariomycetes; Xylariomycetidae; Amphisphaeriales; Apiosporaceae; Apiospora. REFERENCE 1 (bases 1 to 3114) AUTHORS Sorensen,T. TITLE Analysis of 21 Apiospora genomes using comparative genomics revels a genus with tremendous synthesis potential of carbohydrate active enzymes and secondary metabolites JOURNAL Unpublished REFERENCE 2 (bases 1 to 3114) CONSRTM NCBI Genome Project TITLE Direct Submission JOURNAL Submitted (26-JUL-2024) National Center for Biotechnology Information, NIH, Bethesda, MD 20894, USA REFERENCE 3 (bases 1 to 3114) AUTHORS Sorensen,T. TITLE Direct Submission JOURNAL Submitted (13-JAN-2023) Department of Biosciences and Chemistry, Aalborg university, Fredrik Bajers Vej 7H, Aalborg, Nordjylland 9220, Denmark COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. This record is derived from an annotated genomic sequence (NW_027117374). COMPLETENESS: incomplete on both ends. FEATURES Location/Qualifiers source 1..3114 /organism="Apiospora marii" /mol_type="mRNA" /strain="CBS 49790" /culture_collection="CBS:49790" /db_xref="taxon:335849" /chromosome="Unknown" gene <1..>3114 /locus_tag="PG985_005260" /db_xref="GeneID:92058090" CDS 1..3114 /locus_tag="PG985_005260" /note="Argonaute linker 1 domain; Argonaute linker 2 domain; consensus disorder prediction; N-terminal domain of argonaute; PAZ domain profile.; Piwi domain; Piwi domain profile." /codon_start=1 /product="argonaute" /protein_id="XP_066688189.1" /db_xref="GeneID:92058090" /translation="
MSAGHKRGAGGGSASGSGPGQGSQRGSQSPAQHPPLTDRTADKGKQPAGGSDDQASSSKDKMPEAPKEITAQELKKLVDLPPGAFRTGDSDPEFTKRPGYNNDFVATVNLLVNMYQVTELPEAQDSVFQFSVLAAPNPKDSKTLAKRLWDSDTVQKWLKEHSKKLGRWIYDGRAMAWSLDPLPKEGVKIPVILPKKQQNSSTSKGGKGGKDPQAPDRFTLTIKPTTSFTLNQLDDYLTSKPGSKWDDVTTRQFNFLDHLLREGRSKDLTPIRRSFYSKRPQFSKKLGQHTQVITGTYAAFRPMHPMNPEHIRMCVNVDVAHTAFWNHRSTLHAAAMDMLLKSDFDGKCYGADWILEYLTDHDRVAQVNWQNVTQQLKPVRRGTDICMSEAFHMLRRLERTKFTIAHGKADKDKIYTVGSIFFDAKKYPNGADATNVSFTKKREDGSQFSSTVEAHFRSIGKTLQHPEFPLIKTPHGEVYFPFEVCYFAPMQRYTSKLLPDEKPIPWKTSAMIKAAISRPDKRHSDITRSVKELKLDKDDYLKAFGVTINTEGGMLRAHGRILSRPALEFRTKLDVPESHRWNLNNIKFHEGKPLKNWMAINCDNTKTPADCREFFTTFLNVYKSHAGVAIDTQAKHIENLKIISDLTEQRIKEMYKILEGKAKKYQPDAPVQMVFFLLPKRHIKVYNRIKKVMDCDLKIPSQVMTWEKIDLQNSPNALSQYCSNVSLKVNAKLGGVNCYARPAGGNKTSGYFSTKTMFIGLDVSHAPPGTNEASMAALAVSIDPRAIKYGAACQTNGVRTEMVRPDTMKSLLPRFIHRWRKEHNTHERLKGGGPDHLYFFRDGVDAGQFRDVLRTEVQAIKETFIEEIQESPKITVIIVTKRHHVRMFNADPNKGSAASRKHFDKNDNPKPGLLVEQGATHPEYWDFFLTSHNAIQGTSRPIHYQVILDEIECNPNDLQRMIFHHCYQYCRSTLPVSFHPAAFYAHIVSKRAVAHLQPPAPPTAAGQLPDPLPLLPMRDSTLLRHESSSIEQVMWFV"
misc_feature 511..780
/locus_tag="PG985_005260"
/note="N-terminal domain of argonaute; Region: ArgoN;
pfam16486"
/db_xref="CDD:465134"
misc_feature 808..975
/locus_tag="PG985_005260"
/note="Argonaute linker 1 domain; Region: ArgoL1;
pfam08699"
/db_xref="CDD:462567"
misc_feature 1108..1455
/locus_tag="PG985_005260"
/note="PAZ domain, named PAZ after the proteins Piwi
Argonaut and Zwille. PAZ is found in two families of
proteins that are essential components of RNA-mediated
gene-silencing pathways, including RNA interference, the
piwi and Dicer families. PAZ functions as a...; Region:
PAZ; cl00301"
/db_xref="CDD:469713"
misc_feature order(1243..1245,1354..1356,1366..1368,1432..1434,
1438..1440)
/locus_tag="PG985_005260"
/note="nucleic acid-binding interface [nucleotide
binding]; other site"
/db_xref="CDD:239207"
misc_feature <1309..1503
/locus_tag="PG985_005260"
/note="PAZ domain; Region: PAZ; pfam02170"
/db_xref="CDD:460472"
misc_feature 1618..2988
/locus_tag="PG985_005260"
/note="PIWI domain. Domain found in proteins involved in
RNA silencing. RNA silencing refers to a group of related
gene-silencing mechanisms mediated by short RNA molecules,
including siRNAs, miRNAs, and heterochromatin-related
guide RNAs. The central component...; Region: Piwi-like;
cl00628"
/db_xref="CDD:412485"
misc_feature order(2056..2058,2068..2070,2104..2115,2122..2124,
2161..2163,2170..2172,2182..2184,2194..2196)
/locus_tag="PG985_005260"
/note="5' RNA guide strand anchoring site [active]"
/db_xref="CDD:239208"
misc_feature order(2284..2286,2290..2292,2524..2526,2956..2958)
/locus_tag="PG985_005260"
/note="active site"
/db_xref="CDD:239208"
ORIGIN
atgtctgccggccataagcgcggcgcgggtgggggcagcgcgtcggggtccggacccggtcagggatctcaacgcgggtctcagtcgcctgcgcagcatcccccgttgactgacagaactgccgacaagggcaaacaaccggctggcggttcagatgatcaggctagtagttccaaggacaagatgcccgaggctccgaaagagataactgcgcaggaacttaagaaactagtagacttgccacctggcgcattccgcactggagattcggatcccgagttcacaaaacgaccgggctacaataacgatttcgtggcgactgtgaacttgcttgtcaacatgtaccaggtaacggagctacccgaagcccaggatagcgtcttccagttctccgtcttggccgccccaaacccaaaggactcgaagactttagccaaacgactttgggattctgacactgtccaaaagtggttgaaagaacacagcaagaagttgggacgttggatctacgatggccgagctatggcatggtcgcttgacccgttgcctaaggaaggggtgaaaatcccggtcattcttcctaagaagcagcagaactcttcgactagcaagggcggcaagggcggcaaagatccccaggcccctgaccgatttacattaactatcaagccgaccacctcgttcacactcaatcagctagacgactatctcactagcaagcccggctctaagtgggacgacgtcacgacgaggcagttcaacttcctcgatcatctgctgcgggaaggacgatcaaaggatcttactcctatccgacgaagcttctacagcaaacgaccccagtttagcaagaagctgggtcaacacacgcaagtcataacgggcacgtatgccgcgttcagaccgatgcatccaatgaaccccgaacacatccggatgtgtgtcaatgtagatgttgctcacacggcattctggaatcacaggtccactctgcatgcggcagctatggatatgcttctgaagagcgatttcgatggtaagtgctatggtgccgactggatactcgaataccttactgaccatgaccgcgtcgcccaagttaattggcagaatgtcacacaacaactgaagcccgtccgacgaggtaccgatatctgcatgtctgaagccttccacatgttgcggcgactcgaaaggaccaagttcaccattgcccacggcaaggccgacaaggacaagatctacacggtgggtagcatcttctttgacgccaagaagtatcccaacggcgcggatgcgaccaatgtttcatttacgaagaagagagaggatggatcgcaattcagctccacggtcgaggcgcatttccgatcgatcgggaagacactccagcatcccgagtttccgctcatcaaaacacctcatggggaggtttacttcccgtttgaagtatgttacttcgccccgatgcagcggtatacttccaagcttctcccagatgagaaacctattccctggaagacctcagcgatgatcaaggcggccatctcccgcccggataagagacacagtgatattaccagaagtgtcaaagagcttaaattggataaagacgactacctcaaggcattcggcgtcaccatcaacaccgaggggggcatgcttcgcgcccatggccgtatccttagtcggccggccctcgagtttcgtacaaaacttgacgtcccagagagccatcgatggaatttgaacaatatcaagtttcatgaggggaagccactcaagaattggatggctatcaattgcgataacaccaaaacaccagctgattgccgagagttcttcaccacctttttgaacgtgtacaagtcgcatgctggtgtcgcgattgatacgcaagcgaaacatattgagaatctcaagattatttccgatctgacagagcagcgcatcaaggagatgtacaagatactagaaggcaaggcaaagaaataccagccggatgcacctgtacaaatggttttcttcctcttgccaaagagacacatcaaggtctacaaccggatcaaaaaggttatggactgcgatttgaagattccttctcaggtcatgacttgggaaaagattgatcttcagaatagtcccaacgcgcttagtcaatactgcagcaatgtgtcgctgaaggtcaatgcgaagctggggggtgtcaattgttacgcaagacccgcagggggtaacaaaacgtccggctacttctcgacgaagaccatgttcattggtctcgacgtgtctcacgcgccccccggaaccaacgaggcttctatggctgcgttggccgtatcgattgatccacgcgccatcaaatacggcgctgcttgtcagaccaacggagtccgtaccgagatggtgcgtccggatacgatgaagtctctgctgcctcgcttcatacatcggtggcgcaaagagcacaacacacacgaaaggctcaagggaggcgggcccgatcacctctacttcttccgagacggcgtggatgcaggccagttccgcgacgtccttcgcaccgaggtacaagccatcaaggaaacctttatagaggagatccaggagtcacccaagataacggtcatcatcgtcactaagcgacatcacgtacggatgttcaacgcggacccgaacaaggggtcggctgcgagccgcaaacactttgacaaaaacgacaaccccaagccgggcctgctagtggagcaaggggccacgcatccggagtattgggacttcttcctcacttcccacaacgccattcagggcacctcgcgccccatccactaccaggtcatcctagacgagatcgaatgcaatccaaatgatcttcaacgcatgatctttcatcattgctaccagtattgtcgctccaccctgcccgtctcatttcaccccgccgccttttacgctcacatagtttcgaagcgtgctgtggcccatttgcagcctccggctccgccgacggcagcgggacagctaccagacccgttgcctcttctccccatgagagattctacgctcctgcggcatgagtccagtagcatcgagcaggtcatgtggtttgtctag
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]