LOCUS       XM_057572505            1494 bp    mRNA    linear   PLN 27-JUN-2023
DEFINITION  PREDICTED: Lotus japonicus protein argonaute 12-like
            (LOC130721920), transcript variant X1, mRNA.
ACCESSION   XM_057572505
VERSION     XM_057572505.1
DBLINK      BioProject: PRJNA984304
KEYWORDS    RefSeq.
SOURCE      Lotus japonicus
  ORGANISM  Lotus japonicus
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
            Spermatophyta; Magnoliopsida; eudicotyledons; Gunneridae;
            Pentapetalae; rosids; fabids; Fabales; Fabaceae; Papilionoideae; 50
            kb inversion clade; NPAAA clade; Hologalegina; robinioid clade;
            Loteae; Lotus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_080046) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Full annotation
            Annotation Name             :: GCF_012489685.1-RS_2023_06
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.1
            Annotation Method           :: Gnomon; cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 06/21/2023
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..1494
                     /organism="Lotus japonicus"
                     /mol_type="mRNA"
                     /db_xref="taxon:34305"
                     /chromosome="6"
                     /ecotype="B-129"
     gene            1..1494
                     /gene="LOC130721920"
                     /note="protein argonaute 12-like; Derived by automated
                     computational analysis using gene prediction method:
                     Gnomon."
                     /db_xref="GeneID:130721920"
     CDS             230..1369
                     /gene="LOC130721920"
                     /codon_start=1
                     /product="protein argonaute 10-like isoform X1"
                     /protein_id="XP_057428488.1"
                     /db_xref="GeneID:130721920"
                     /translation="

MSHRQTQLHHRPSSVRRGRAREPPLPPPSISRRRGGFRPPRLPSHPIFHSSSDRGQAPPPSSPPPSAPERGHASSSPSPPVSTESLPSAPTQMDLSLNTDVPVSIIDYISQQCGIDCSLSVSDEDRVKVNKTLTGLEFEVSIQGHPEIRYTIGGVSIREVNKLMFTLLDKTLSVCEYWEGKYKVKLEYKHLPAIRVGSEKKPTYFPMEFCKIVREAIKTPCDREGDIKKIVKRRKKFKDYKLVQHSNMQVDEDPTAIEARVLPSPKLKSHDPDTKARDTPPMGQLNLSKMKMENGGNLTRWGCLNFSKLGTDCVAGFCAKLGDICTAMGMVFNSTPVIPMKSAESAKLRKEIDEIHKQEGRLQLLLIILPEVKNIYMEK"

     misc_feature    <497..>1357
                     /gene="LOC130721920"
                     /note="protein argonaute; Provisional; Region: PLN03202"
                     /db_xref="CDD:215631"
     misc_feature    533..868
                     /gene="LOC130721920"
                     /note="PAZ domain, argonaute_like subfamily. Argonaute is
                     part of the RNA-induced silencing complex (RISC), and is
                     an endonuclease that plays a key role in the RNA
                     interference pathway. The PAZ domain has been named after
                     the proteins Piwi,Argonaut, and Zwille; Region:
                     PAZ_argonaute_like; cd02846"
                     /db_xref="CDD:239212"
     misc_feature    order(677..679,722..724,749..751,761..763,815..817,
                     836..838,842..844)
                     /gene="LOC130721920"
                     /note="nucleic acid-binding interface [nucleotide
                     binding]; other site"
                     /db_xref="CDD:239212"
ORIGIN      

acctgtgtgtgctctgttttttttgcttcttcttcttctttgagagtagagtacattgattacattttgctgcagaaagcatctttgatgacgaccatggagcaattattaatgctcagagaagaaactcacgccaattcaaccctacctacctcactgagtctaaccgtcgctcctcactctccaacttctttttcttccgatcaactccctaccgtcgcaaatcacaatgtcgcatcggcaaactcaacttcaccaccgtccttcctcagtccgccgcggtcgtgcacgtgaaccgccgctccctcctccttccataagccgtcggcgtggcggtttccgaccaccgaggctcccttcacatcctatttttcattcttcatcagaccgtggccaggcacctccgccgtcttctcctcctccgtcagcccccgagcgtggtcatgcatcttcctcgccttctccacctgtttctaccgagtcattgccgtccgcgccaactcagatggacctctctctcaacacagatgtcccagtttctatcatagactatatttctcaacaatgtgggatagattgttcactttctgtgtcagatgaagatcgtgttaaggtaaacaaaacactgactggcttggaatttgaagtttccatccaaggtcaccctgaaatacggtataccattggtggtgtttcaataagagaagtgaacaaattaatgttcacacttcttgataaaacattatctgtttgtgaatactgggaaggaaaatacaaggttaaattggaatacaaacacttacctgctattcgagtgggaagtgaaaaaaagcccacgtatttcccaatggagttttgtaaaattgttagggaagccattaagaccccttgcgatagggagggagatataaaaaagattgtcaaaaggaggaagaagttcaaggattataaacttgtacaacattccaacatgcaagtagatgaggatcctaccgcaattgaggcccgtgttttgccatccccaaagctgaaatctcacgatccagacacaaaagcaagagatacaccaccgatgggtcagttgaatctaagtaaaatgaaaatggaaaatggtggtaatctgacacgatggggctgtctcaatttttcaaaattgggaacagactgtgtagctggtttttgtgcaaaattgggtgacatctgcacggccatgggaatggttttcaactcaacccctgtaattcctatgaagtcggcagaatctgcaaagttaagaaaagagattgacgagatacacaagcaagaaggaagattacaattgcttttgataattttaccagaggtcaagaatatatatatggagaaataaagctaatttgtgaaacgcaaataggcattatgacccagtgttgcaagcctgaaaaagtcaaaaaatgttctaaggactttcttcaaagtctcgccctcaagatcaatgttaaggttggcgggatc

//