LOCUS       XM_050281915            1438 bp    mRNA    linear   PLN 25-AUG-2022
DEFINITION  PREDICTED: Malus sylvestris protein argonaute MEL1-like
            (LOC126614318), transcript variant X5, mRNA.
ACCESSION   XM_050281915
VERSION     XM_050281915.1
DBLINK      BioProject: PRJNA824043
KEYWORDS    RefSeq.
SOURCE      Malus sylvestris (European crab apple)
  ORGANISM  Malus sylvestris
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
            Spermatophyta; Magnoliopsida; eudicotyledons; Gunneridae;
            Pentapetalae; rosids; fabids; Rosales; Rosaceae; Amygdaloideae;
            Maleae; Malus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_062262) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Full annotation
            Annotation Name             :: Malus sylvestris Annotation Release
                                           100
            Annotation Version          :: 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.0
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..1438
                     /organism="Malus sylvestris"
                     /mol_type="mRNA"
                     /db_xref="taxon:3752"
                     /chromosome="3"
     gene            1..1438
                     /gene="LOC126614318"
                     /note="protein argonaute MEL1-like; Derived by automated
                     computational analysis using gene prediction method:
                     Gnomon. Supporting evidence includes similarity to: 2 long
                     SRA reads, 1 Protein"
                     /db_xref="GeneID:126614318"
     CDS             407..1270
                     /gene="LOC126614318"
                     /codon_start=1
                     /product="protein argonaute MEL1-like isoform X4"
                     /protein_id="XP_050137872.1"
                     /db_xref="GeneID:126614318"
                     /translation="

MVTEFVKKLLSNRQLSRPLPDRDRLKEKKPLKGVKVPLSYEEHTGYEITRVSVEPQSKLKFTHERYNIGLRDVATPALQTGRDSKPVYLPMEVPVQMVKHNGHNKDEVIQREIGMTIREDMTLVNARVLWPPLKMFNGVQVDFWAYVDFSLLDQSFNFRFCEDLVRPCNSKGVHFHPQPLLLHQSAHPGKIERVLGDIHKMSGKQLEEVGQKGRHLQLLIIILPDVTGLYEKMIKRFRESELGVVSQCCQPTAASRLSKQYLENLSLEISEVWWKEHCCHSKKDSSS"

     misc_feature    410..685
                     /gene="LOC126614318"
                     /note="PAZ domain, argonaute_like subfamily. Argonaute is
                     part of the RNA-induced silencing complex (RISC), and is
                     an endonuclease that plays a key role in the RNA
                     interference pathway. The PAZ domain has been named after
                     the proteins Piwi,Argonaut, and Zwille; Region:
                     PAZ_argonaute_like; cd02846"
                     /db_xref="CDD:239212"
     misc_feature    737..>1213
                     /gene="LOC126614318"
                     /note="PIWI domain. Domain found in proteins involved in
                     RNA silencing. RNA silencing refers to a group of related
                     gene-silencing mechanisms mediated by short RNA molecules,
                     including siRNAs, miRNAs, and heterochromatin-related
                     guide RNAs. The central component...; Region: Piwi-like;
                     cl00628"
                     /db_xref="CDD:412485"
     misc_feature    order(1094..1096,1109..1111,1145..1156,1160..1162,
                     1187..1189,1196..1198,1208..1210)
                     /gene="LOC126614318"
                     /note="5' RNA guide strand anchoring site [active]"
                     /db_xref="CDD:239208"
ORIGIN      

taatagttgtttgctcttcattatcgtttggaatcagaaaggggttttgagaaactcaaatgatttttgggtcccaaaacgccatgagtgactacagtttcaaaaaaccgaagaataaaaactaaaaaaaaaggcaaaagaaaaattcagaaaataaaatacaaatttttaatttaaatttggaaagggaaacctgaacagtacaaatgcagatgcacatataaacacagaaaaataagaacaaaaggaacactgcagaaagaaagaaagggaggaaactcaagtgctggatgttgctctgaaggccgcacctccataaaagtactcgtctttcgccactgagcttgggcagaaaggtggtgatcttggtgaagatgtattggccagagcaatttataagcctattatggtaactgagtttgtcaaaaaacttttgagcaacagacaactgtccaggcctttgcctgatcgtgatcgtttgaaggagaaaaagcccttaaagggggtcaaggtaccgctttcttatgaagagcataccggttatgaaatcactagggtgtcagttgaaccacagagcaagttgaagttcactcatgagaggtacaatattgggctaagggatgtggcaacgcctgcgcttcaaactgggagggattcaaaacctgtttatttgccaatggaggtacctgtacagatggttaaacacaatggtcacaataaagatgaggttatccaacgggaaattggaatgactataagagaagatatgactttagttaatgctcgtgttctgtggccgcctttgaaaatgtttaacggtgttcaagtggatttctgggcatatgttgatttttccctattggaccaaagttttaacttccgattctgtgaggatttggtccgtccgtgcaacagcaagggagtgcatttccatccgcaacctttacttctgcatcaatcagctcatcctgggaaaatagagagggtgctcggagatatccataagatgtctggcaagcaacttgaagaagttggacagaagggaaggcatcttcagttgttaattatcattttgcctgatgtcactggattatatgaaaagatgataaaacgattccgggaaagtgagttaggagtcgtatctcagtgctgtcagcctacagcagcatcgaggctcagcaaacaatatttagaaaatttgtcgctcgagataagtgaagtttggtggaaggaacactgttgccattcgaagaaggattcctctagttagtgacatccccacaatcatctttgctgcggatgttacccatcctcaacctgggaaggacagcagtctgtcaattgcagctgtggtggcgtcaatagattggccacagataatccaagatctttatagtgtaaaccaggatcctaacaatggtcttgttggaggaggaat

//