GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2026-06-17 17:15:00, GGRNA.v2 : RefSeq release 233 (Jan, 2026)

LOCUS       XM_010138084            1034 bp    mRNA    linear   VRT 06-NOV-2014
DEFINITION  PREDICTED: Buceros rhinoceros silvestris testis- and ovary-specific
            PAZ domain-containing protein 1-like (LOC104495146), partial mRNA.
ACCESSION   XM_010138084
VERSION     XM_010138084.1
DBLINK      BioProject: PRJNA266010
KEYWORDS    RefSeq; includes ab initio.
SOURCE      Buceros rhinoceros silvestris
  ORGANISM  Buceros rhinoceros silvestris
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
            Coelurosauria; Aves; Neognathae; Neoaves; Telluraves;
            Coraciimorphae; Bucerotiformes; Bucerotidae; Buceros.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_010390492.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Version          :: Buceros rhinoceros silvestris
                                           Annotation Release 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 6.1
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
            
            ##RefSeq-Attributes-START##
            ab initio :: 6% of CDS bases
            ##RefSeq-Attributes-END##
            COMPLETENESS: incomplete on the 5' end.
FEATURES             Location/Qualifiers
     source          1..1034
                     /organism="Buceros rhinoceros silvestris"
                     /mol_type="mRNA"
                     /isolate="BGI_N320"
                     /sub_species="silvestris"
                     /db_xref="taxon:175836"
                     /chromosome="Unknown"
                     /sex="male"
     gene            <1..1034
                     /gene="LOC104495146"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 1 Protein"
                     /db_xref="GeneID:104495146"
     CDS             <1..1034
                     /gene="LOC104495146"
                     /codon_start=3
                     /product="testis- and ovary-specific PAZ domain-containing
                     protein 1-like"
                     /protein_id="XP_010136386.1"
                     /db_xref="GeneID:104495146"
                     /translation="
IKNSQHNEADRIFIGRIGISVIYSYHKVLQWIKGRKVLDKLYELQIHFTVLKGLTDAGRFASRCQIVNKAAEFFIQTGSLDGATWVLRESEWTTNAPLWPCNKTDILDRHNLLCTLVHKYLRRNLYRQALEVLQNLPGFQNDSDTTDVSQYSCLFNKLINACFESKNLGISSSAVDFMLSKNIAIDFSVLRGLITALGRNSLWSKARTYYKSALSLGCYLPLQGNFYHERLMMPSYLSEVEMLLAIEVFLVSNANYIQSPMAISHTLQIILKRCEDQTVQNNGDYQASVERLTLAARISDPKLFLKHMTVNINREEVYSLELTSALKWLQENMKWAGKVWLFQ"
     misc_feature    <1..347
                     /gene="LOC104495146"
                     /note="Putative aspartate racemase; Region:
                     Asp_Glu_race_2; pfam14669"
                     /db_xref="CDD:464250"
     misc_feature    345..413
                     /gene="LOC104495146"
                     /note="PPR repeat [structural motif]; Region: PPR repeat"
                     /db_xref="CDD:276811"
     misc_feature    429..545
                     /gene="LOC104495146"
                     /note="PPR repeat [structural motif]; Region: PPR repeat"
                     /db_xref="CDD:276811"
     misc_feature    561..635
                     /gene="LOC104495146"
                     /note="PPR repeat [structural motif]; Region: PPR repeat"
                     /db_xref="CDD:276811"
ORIGIN      
taataaaaaattcacaacataatgaagcagacagaattttcattggaaggattgggataagtgtaatatattcttatcacaaagtactgcagtggataaagggaaggaaggttttagataaattgtatgagctacagatacattttacagtcctgaaaggacttacagatgcagggaggttcgcatcaagatgtcaaatagttaataaagctgcagaattttttattcagactggaagtttggatggagcgacatgggtgttgagagagtcagagtggaccacaaatgcaccattgtggccctgtaataaaacagacatccttgatcgccataatctgctatgtacactcgtgcacaagtacttgaggaggaatttatacaggcaggcacttgaagttctgcagaacttaccaggttttcaaaatgattctgatactacagatgtttctcagtacagctgcctttttaacaaactgataaatgcctgttttgagagcaagaaccttgggatctcatcttctgcagtagacttcatgctttcaaaaaacatagctattgatttttctgtacttagaggattaatcactgctttgggaagaaattctttgtggtctaaagctaggacctattacaaaagtgctttatcattgggttgctacctaccactgcagggaaatttctatcacgaacgtttgatgatgccgtcgtacctgtctgaggttgagatgctgttggccattgaagtatttcttgtttcaaatgccaattatattcaaagtccaatggctattagtcacactcttcaaataatactgaaaagatgtgaagatcagacagttcagaacaacggtgactatcaagcatcagtggagagactgaccctggctgctcgtatatctgatccaaagctttttcttaagcatatgacagtgaatattaatagggaagaagtttacagcttggagcttacatctgctctaaaatggcttcaggagaatatgaaatgggctggcaaggtctggctgtttcagtag
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]