GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2026-09-29 00:40:05, GGRNA.v2 : RefSeq release 233 (Jan, 2026)

LOCUS       NR_030486                 82 bp    RNA     linear   ROD 05-AUG-2023
DEFINITION  Mus musculus microRNA 705 (Mir705), microRNA.
ACCESSION   NR_030486
VERSION     NR_030486.1
KEYWORDS    RefSeq.
SOURCE      Mus musculus (house mouse)
  ORGANISM  Mus musculus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Mus; Mus.
REFERENCE   1  (bases 1 to 82)
  AUTHORS   Liao L, Su X, Yang X, Hu C, Li B, Lv Y, Shuai Y, Jing H, Deng Z and
            Jin Y.
  TITLE     TNF-alpha Inhibits FoxO1 by Upregulating miR-705 to Aggravate
            Oxidative Damage in Bone Marrow-Derived Mesenchymal Stem Cells
            during Osteoporosis
  JOURNAL   Stem Cells 34 (4), 1054-1067 (2016)
   PUBMED   26700816
  REMARK    GeneRIF: Inhibition of NF-kappaB pathway or knockdown of miR-705
            largely prevented the decline of FoxO1-mediated antioxidant defense
            caused by TNF-alpha and ameliorated the oxidative damage in
            osteoporotic bone marrow-derived mesenchymal stem cells
REFERENCE   2  (bases 1 to 82)
  AUTHORS   Liao L, Yang X, Su X, Hu C, Zhu X, Yang N, Chen X, Shi S, Shi S and
            Jin Y.
  TITLE     Redundant miR-3077-5p and miR-705 mediate the shift of mesenchymal
            stem cell lineage commitment to adipocyte in osteoporosis bone
            marrow
  JOURNAL   Cell Death Dis 4 (4), e600 (2013)
   PUBMED   23598412
  REMARK    GeneRIF: The miR-705 is acted as inhibitors of MSCs osteoblast
            differentiation and promoters of adipocyte differentiation, by
            targeting on the 3'untranslated region (3'UTR) of HOXA10 and RUNX2
            mRNA.
            Publication Status: Online-Only
REFERENCE   3  (bases 1 to 82)
  AUTHORS   Prosser HM, Koike-Yusa H, Cooper JD, Law FC and Bradley A.
  TITLE     A resource of vectors and ES cells for targeted deletion of
            microRNAs in mice
  JOURNAL   Nat Biotechnol 29 (9), 840-845 (2011)
   PUBMED   21822254
  REMARK    Publication Status: Online-Only
REFERENCE   4  (bases 1 to 82)
  AUTHORS   Aoi W, Naito Y, Mizushima K, Takanami Y, Kawai Y, Ichikawa H and
            Yoshikawa T.
  TITLE     The microRNA miR-696 regulates PGC-1{alpha} in mouse skeletal
            muscle in response to physical activity
  JOURNAL   Am J Physiol Endocrinol Metab 298 (4), E799-E806 (2010)
   PUBMED   20086200
REFERENCE   5  (bases 1 to 82)
  AUTHORS   van Rooij E, Sutherland LB, Thatcher JE, DiMaio JM, Naseem RH,
            Marshall WS, Hill JA and Olson EN.
  TITLE     Dysregulation of microRNAs after myocardial infarction reveals a
            role of miR-29 in cardiac fibrosis
  JOURNAL   Proc Natl Acad Sci U S A 105 (35), 13027-13032 (2008)
   PUBMED   18723672
REFERENCE   6  (bases 1 to 82)
  AUTHORS   Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M,
            Asada K, Mirochnitchenko O, Inouye M and Kato I.
  TITLE     The expression profile of microRNAs in mouse embryos
  JOURNAL   Nucleic Acids Res 34 (6), 1765-1771 (2006)
   PUBMED   16582102
  REMARK    Publication Status: Online-Only
REFERENCE   7  (bases 1 to 82)
  AUTHORS   Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright
            AJ.
  TITLE     miRBase: microRNA sequences, targets and gene nomenclature
  JOURNAL   Nucleic Acids Res 34 (Database issue), D140-D144 (2006)
   PUBMED   16381832
COMMENT     PROVISIONAL REFSEQ: This record is based on preliminary annotation
            provided by NCBI staff in collaboration with miRBase. The reference
            sequence was derived from AC153605.2.
            
            Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs
            that are involved in post-transcriptional regulation of gene
            expression in multicellular organisms by affecting both the
            stability and translation of mRNAs. miRNAs are transcribed by RNA
            polymerase II as part of capped and polyadenylated primary
            transcripts (pri-miRNAs) that can be either protein-coding or
            non-coding. The primary transcript is cleaved by the Drosha
            ribonuclease III enzyme to produce an approximately 70-nt stem-loop
            precursor miRNA (pre-miRNA), which is further cleaved by the
            cytoplasmic Dicer ribonuclease to generate the mature miRNA and
            antisense miRNA star (miRNA*) products. The mature miRNA is
            incorporated into a RNA-induced silencing complex (RISC), which
            recognizes target mRNAs through imperfect base pairing with the
            miRNA and most commonly results in translational inhibition or
            destabilization of the target mRNA. The RefSeq represents the
            predicted microRNA stem-loop. [provided by RefSeq, Sep 2009].
            
            Sequence Note: This record represents a predicted microRNA
            stem-loop as defined by miRBase. Some sequence at the 5' and 3'
            ends may not be included in the intermediate precursor miRNA
            produced by Drosha cleavage.
            
            ##Evidence-Data-START##
            Transcript is intronless :: AK078938.1, CX221927.1 [ECO:0000345]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-82                AC153605.2         219682-219763       c
FEATURES             Location/Qualifiers
     source          1..82
                     /organism="Mus musculus"
                     /mol_type="transcribed RNA"
                     /strain="C57BL/6"
                     /db_xref="taxon:10090"
                     /chromosome="6"
                     /map="6 37.35 cM"
     gene            1..82
                     /gene="Mir705"
                     /gene_synonym="Mirn705; mmu-mir-705"
                     /note="microRNA 705"
                     /db_xref="GeneID:735267"
                     /db_xref="MGI:MGI:3629673"
                     /db_xref="miRBase:MI0004689"
     precursor_RNA   1..82
                     /gene="Mir705"
                     /gene_synonym="Mirn705; mmu-mir-705"
                     /product="microRNA 705"
                     /db_xref="GeneID:735267"
                     /db_xref="MGI:MGI:3629673"
                     /db_xref="miRBase:MI0004689"
     exon            1..82
                     /gene="Mir705"
                     /gene_synonym="Mirn705; mmu-mir-705"
                     /inference="alignment:Splign:2.1.0"
     ncRNA           14..33
                     /ncRNA_class="miRNA"
                     /gene="Mir705"
                     /gene_synonym="Mirn705; mmu-mir-705"
                     /product="mmu-miR-705"
                     /db_xref="miRBase:MIMAT0003495"
                     /db_xref="GeneID:735267"
                     /db_xref="MGI:MGI:3629673"
                     /db_xref="miRBase:MI0004689"
ORIGIN      
atgtcccagtagtggtgggaggtggggtgggcacagagggaatgacttctttctcctgcagtcctccctacctccctaacat
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]