GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2026-09-29 00:40:09, GGRNA.v2 : RefSeq release 233 (Jan, 2026)

LOCUS       NR_030449                 87 bp    RNA     linear   ROD 06-AUG-2023
DEFINITION  Mus musculus microRNA 680-3 (Mir680-3), microRNA.
ACCESSION   NR_030449
VERSION     NR_030449.1
KEYWORDS    RefSeq.
SOURCE      Mus musculus (house mouse)
  ORGANISM  Mus musculus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Mus; Mus.
REFERENCE   1  (bases 1 to 87)
  AUTHORS   Tarantino C, Paolella G, Cozzuto L, Minopoli G, Pastore L, Parisi S
            and Russo T.
  TITLE     miRNA 34a, 100, and 137 modulate differentiation of mouse embryonic
            stem cells
  JOURNAL   FASEB J 24 (9), 3255-3263 (2010)
   PUBMED   20439489
REFERENCE   2  (bases 1 to 87)
  AUTHORS   Aoi W, Naito Y, Mizushima K, Takanami Y, Kawai Y, Ichikawa H and
            Yoshikawa T.
  TITLE     The microRNA miR-696 regulates PGC-1{alpha} in mouse skeletal
            muscle in response to physical activity
  JOURNAL   Am J Physiol Endocrinol Metab 298 (4), E799-E806 (2010)
   PUBMED   20086200
REFERENCE   3  (bases 1 to 87)
  AUTHORS   Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M,
            Asada K, Mirochnitchenko O, Inouye M and Kato I.
  TITLE     The expression profile of microRNAs in mouse embryos
  JOURNAL   Nucleic Acids Res 34 (6), 1765-1771 (2006)
   PUBMED   16582102
  REMARK    Publication Status: Online-Only
REFERENCE   4  (bases 1 to 87)
  AUTHORS   Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright
            AJ.
  TITLE     miRBase: microRNA sequences, targets and gene nomenclature
  JOURNAL   Nucleic Acids Res 34 (Database issue), D140-D144 (2006)
   PUBMED   16381832
COMMENT     PROVISIONAL REFSEQ: This record is based on preliminary annotation
            provided by NCBI staff in collaboration with miRBase. The reference
            sequence was derived from AC122314.4.
            
            Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs
            that are involved in post-transcriptional regulation of gene
            expression in multicellular organisms by affecting both the
            stability and translation of mRNAs. miRNAs are transcribed by RNA
            polymerase II as part of capped and polyadenylated primary
            transcripts (pri-miRNAs) that can be either protein-coding or
            non-coding. The primary transcript is cleaved by the Drosha
            ribonuclease III enzyme to produce an approximately 70-nt stem-loop
            precursor miRNA (pre-miRNA), which is further cleaved by the
            cytoplasmic Dicer ribonuclease to generate the mature miRNA and
            antisense miRNA star (miRNA*) products. The mature miRNA is
            incorporated into a RNA-induced silencing complex (RISC), which
            recognizes target mRNAs through imperfect base pairing with the
            miRNA and most commonly results in translational inhibition or
            destabilization of the target mRNA. The RefSeq represents the
            predicted microRNA stem-loop. [provided by RefSeq, Sep 2009].
            
            Sequence Note: This record represents a predicted microRNA
            stem-loop as defined by miRBase. Some sequence at the 5' and 3'
            ends may not be included in the intermediate precursor miRNA
            produced by Drosha cleavage.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-87                AC122314.4         79836-79922
FEATURES             Location/Qualifiers
     source          1..87
                     /organism="Mus musculus"
                     /mol_type="transcribed RNA"
                     /strain="C57BL/6"
                     /db_xref="taxon:10090"
                     /chromosome="12"
                     /map="12 15.71 cM"
     gene            1..87
                     /gene="Mir680-3"
                     /gene_synonym="Mirn680-3"
                     /note="microRNA 680-3"
                     /db_xref="GeneID:751520"
                     /db_xref="MGI:MGI:3629889"
                     /db_xref="miRBase:MI0004642"
     precursor_RNA   1..87
                     /gene="Mir680-3"
                     /gene_synonym="Mirn680-3"
                     /product="microRNA 680-3"
                     /db_xref="GeneID:751520"
                     /db_xref="MGI:MGI:3629889"
                     /db_xref="miRBase:MI0004642"
     exon            1..87
                     /gene="Mir680-3"
                     /gene_synonym="Mirn680-3"
                     /inference="alignment:Splign:2.1.0"
     ncRNA           29..49
                     /ncRNA_class="miRNA"
                     /gene="Mir680-3"
                     /gene_synonym="Mirn680-3"
                     /product="mmu-miR-680"
                     /db_xref="miRBase:MIMAT0003457"
                     /db_xref="GeneID:751520"
                     /db_xref="MGI:MGI:3629889"
                     /db_xref="miRBase:MI0004642"
ORIGIN      
gggggatttaacaaagaacaaaaaaggtgggcatctgctgacatgggggcagaagtcaggctctaggcagcaggtactcttcatctt
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]