GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2026-09-29 00:40:05, GGRNA.v2 : RefSeq release 233 (Jan, 2026)

LOCUS       NM_204708               2948 bp    mRNA    linear   VRT 24-SEP-2023
DEFINITION  Gallus gallus DEAD-box helicase 4 (DDX4), mRNA.
ACCESSION   NM_204708
VERSION     NM_204708.3
KEYWORDS    RefSeq.
SOURCE      Gallus gallus (chicken)
  ORGANISM  Gallus gallus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
            Coelurosauria; Aves; Neognathae; Galloanserae; Galliformes;
            Phasianidae; Phasianinae; Gallus.
REFERENCE   1  (bases 1 to 2948)
  AUTHORS   Lejong M, Choa-Duterre M, Vanmuylder N and Louryan S.
  TITLE     Is Vasa such a highly specific marker for primordial germ cells? A
            comparison of VASA and HSP90 proteins expression in young chicken
            embryos
  JOURNAL   Morphologie 104 (344), 20-26 (2020)
   PUBMED   32057659
  REMARK    GeneRIF: Is Vasa such a highly specific marker for primordial germ
            cells? A comparison of VASA and HSP90 proteins expression in young
            chicken embryos.
REFERENCE   2  (bases 1 to 2948)
  AUTHORS   Aduma N, Izumi H, Mizushima S and Kuroiwa A.
  TITLE     Knockdown of DEAD-box helicase 4 (DDX4) decreases the number of
            germ cells in male and female chicken embryonic gonads
  JOURNAL   Reprod Fertil Dev 31 (5), 847-854 (2019)
   PUBMED   30554591
  REMARK    GeneRIF: Male and female gonads of DDX4-knockdown embryos contained
            a decreased number of primordial germ cells, indicating that DDX4
            is essential to maintain a normal level of these cells in chicken
            embryos of both sexes.
REFERENCE   3  (bases 1 to 2948)
  AUTHORS   Tang H, Finn RD and Thomas PD.
  TITLE     TreeGrafter: phylogenetic tree-based annotation of proteins with
            Gene Ontology terms and other annotations
  JOURNAL   Bioinformatics 35 (3), 518-520 (2019)
   PUBMED   30032202
REFERENCE   4  (bases 1 to 2948)
  AUTHORS   Burge S, Kelly E, Lonsdale D, Mutowo-Muellenet P, McAnulla C,
            Mitchell A, Sangrador-Vegas A, Yong SY, Mulder N and Hunter S.
  TITLE     Manual GO annotation of predictive protein signatures: the InterPro
            approach to GO curation
  JOURNAL   Database (Oxford) 2012, bar068 (2012)
   PUBMED   22301074
  REMARK    Publication Status: Online-Only
REFERENCE   5  (bases 1 to 2948)
  AUTHORS   Kito G, Aramaki S, Tanaka K, Soh T, Yamauchi N and Hattori MA.
  TITLE     Temporal and spatial differential expression of chicken
            germline-specific proteins cDAZL, CDH and CVH during gametogenesis
  JOURNAL   J Reprod Dev 56 (3), 341-346 (2010)
   PUBMED   20332590
  REMARK    GeneRIF: cDAZL, CDH and CVH are expressed in chicken germ cells,
            but their patterns of expression are temporally and spatially
            distinct
REFERENCE   6  (bases 1 to 2948)
  AUTHORS   Lavial F, Acloque H, Bachelard E, Nieto MA, Samarut J and Pain B.
  TITLE     Ectopic expression of Cvh (Chicken Vasa homologue) mediates the
            reprogramming of chicken embryonic stem cells to a germ cell fate
  JOURNAL   Dev Biol 330 (1), 73-82 (2009)
   PUBMED   19324033
  REMARK    GeneRIF: Thus, our results demonstrate that Vasa can drive ES cell
            differentiation towards the germ cell lineage, both in vitro and in
            vivo
REFERENCE   7  (bases 1 to 2948)
  AUTHORS   Minematsu T, Harumi T and Naito M.
  TITLE     Germ cell-specific expression of GFP gene induced by chicken vasa
            homologue (Cvh) promoter in early chicken embryos
  JOURNAL   Mol Reprod Dev 75 (10), 1515-1522 (2008)
   PUBMED   18324671
  REMARK    GeneRIF: Cvh promoter provide the basis for for visualization,
            purification and genetical modification of germ cells, and might
            further contribute to our understanding of the development,
            proliferation, migration and differentiation of germ cells in the
            chicken
REFERENCE   8  (bases 1 to 2948)
  AUTHORS   Tsunekawa N, Naito M, Sakai Y, Nishida T and Noce T.
  TITLE     Isolation of chicken vasa homolog gene and tracing the origin of
            primordial germ cells
  JOURNAL   Development 127 (12), 2741-2750 (2000)
   PUBMED   10821771
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            JAENSK010000089.1.
            
            On Nov 23, 2021 this sequence version replaced NM_204708.2.
            
            Sequence Note: The RefSeq transcript and protein were derived from
            genomic sequence to make the sequence consistent with the reference
            genome assembly. The genomic coordinates used for the transcript
            record were based on alignments.
            
            ##Evidence-Data-START##
            Transcript exon combination :: SRR13267659.94459.1,
                                           SRR13267654.10508.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMEA103992290 [ECO:0000348]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-42                JAENSK010000089.1  4448155-4448196
            43-143              JAENSK010000089.1  4448385-4448485
            144-270             JAENSK010000089.1  4449861-4449987
            271-339             JAENSK010000089.1  4452158-4452226
            340-414             JAENSK010000089.1  4455227-4455301
            415-501             JAENSK010000089.1  4456118-4456204
            502-585             JAENSK010000089.1  4456828-4456911
            586-627             JAENSK010000089.1  4458815-4458856
            628-770             JAENSK010000089.1  4460052-4460194
            771-923             JAENSK010000089.1  4460898-4461050
            924-1078            JAENSK010000089.1  4467997-4468151
            1079-1208           JAENSK010000089.1  4469265-4469394
            1209-1375           JAENSK010000089.1  4470431-4470597
            1376-1521           JAENSK010000089.1  4474545-4474690
            1522-1621           JAENSK010000089.1  4475530-4475629
            1622-1892           JAENSK010000089.1  4476511-4476781
            1893-1973           JAENSK010000089.1  4476934-4477014
            1974-2948           JAENSK010000089.1  4478969-4479943
FEATURES             Location/Qualifiers
     source          1..2948
                     /organism="Gallus gallus"
                     /mol_type="mRNA"
                     /db_xref="taxon:9031"
                     /chromosome="Z"
                     /map="Z"
     gene            1..2948
                     /gene="DDX4"
                     /note="DEAD-box helicase 4"
                     /db_xref="CGNC:10908"
                     /db_xref="GeneID:395447"
     exon            1..42
                     /gene="DDX4"
                     /inference="alignment:Splign:2.1.0"
     exon            43..143
                     /gene="DDX4"
                     /inference="alignment:Splign:2.1.0"
     CDS             63..2054
                     /gene="DDX4"
                     /EC_number="3.6.4.13"
                     /note="Cvh; DEAD (Asp-Glu-Ala-Asp) box polypeptide 4"
                     /codon_start=1
                     /product="probable ATP-dependent RNA helicase DDX4"
                     /protein_id="NP_990039.2"
                     /db_xref="CGNC:10908"
                     /db_xref="GeneID:395447"
                     /translation="
MEEDWDTELEQEAAAASQGRSEEQAWMANSGRPNSPSLRFSSRPSSPLSGFPGRPNSPFFGFSQNKGSLGANEGLNRSLPVQHDIGGYSGSRESVVRPNREDQPVTRFGRGRSSGSRDFQERNSANDPGMQDQGFRRVPGIFGQSKCFNSEERNSPLRGSPFAPGGRGAVGGPAGVLKGRSEEIDSGRGPKVTYVPPPPPEDEQSIFACYQSGINFDKYDECAVEMSGLDPPAPLLAFEEANFAQTLRKNISKTGYSKLTPVQKHSIPVIQAGRDLMSCAQTGSGKTAAFLLPIVDRMMKDGVTASAFQKQQEPQCIIVAPTRELINQIFLEARKFVYGTCIRPVVIYGGTQTGHSIRQIMQGCNILCATPGRLLDIIEKGKISLVEVKYLVLDEADRMLDMGFGLDMKKLISYPEMPSKDRRQTLMFSATFPEEVQRLAGEFLKTDYIFLVIGNTCGACSDVQQNILQVPRLSKRDKLIEILQSTGGERTMVFVDTKKKADYLAAFLCQENLPSTSIHGDREQREREIALRDFRSGKCQILVATSVASRGLDIENVQHVINFDLPNTIEDYVHRIGRTGRCGNTGKAVSFFDDQSDGHLVQSLLKVLSEAQQEVPVWLEEMAVQRTNIVASLGAQRNNAGRGRMNPREMRMSYSETTFKSWE"
     misc_feature    642..1433
                     /gene="DDX4"
                     /note="DEAD-box helicase domain of DEAD box protein 4;
                     Region: DEADc_DDX4; cd18052"
                     /db_xref="CDD:350810"
     misc_feature    order(708..710,738..740,774..776,828..830,834..842,
                     849..851,903..923,1242..1247,1350..1352)
                     /gene="DDX4"
                     /note="ATP binding site [chemical binding]; other site"
                     /db_xref="CDD:350810"
     misc_feature    order(1023..1031,1107..1112,1170..1181,1188..1190,
                     1254..1256,1272..1274)
                     /gene="DDX4"
                     /note="RNA binding site [nucleotide binding]; other site"
                     /db_xref="CDD:350810"
     misc_feature    1449..1838
                     /gene="DDX4"
                     /note="C-terminal helicase domain of the DEAD box
                     helicases; Region: SF2_C_DEAD; cd18787"
                     /db_xref="CDD:350174"
     misc_feature    order(1713..1715,1719..1721,1794..1796,1803..1808)
                     /gene="DDX4"
                     /note="ATP binding site [chemical binding]; other site"
                     /db_xref="CDD:350174"
     exon            144..270
                     /gene="DDX4"
                     /inference="alignment:Splign:2.1.0"
     exon            271..339
                     /gene="DDX4"
                     /inference="alignment:Splign:2.1.0"
     exon            340..414
                     /gene="DDX4"
                     /inference="alignment:Splign:2.1.0"
     exon            415..501
                     /gene="DDX4"
                     /inference="alignment:Splign:2.1.0"
     exon            502..585
                     /gene="DDX4"
                     /inference="alignment:Splign:2.1.0"
     exon            586..627
                     /gene="DDX4"
                     /inference="alignment:Splign:2.1.0"
     exon            628..770
                     /gene="DDX4"
                     /inference="alignment:Splign:2.1.0"
     exon            771..923
                     /gene="DDX4"
                     /inference="alignment:Splign:2.1.0"
     exon            924..1078
                     /gene="DDX4"
                     /inference="alignment:Splign:2.1.0"
     exon            1079..1208
                     /gene="DDX4"
                     /inference="alignment:Splign:2.1.0"
     exon            1209..1375
                     /gene="DDX4"
                     /inference="alignment:Splign:2.1.0"
     exon            1376..1521
                     /gene="DDX4"
                     /inference="alignment:Splign:2.1.0"
     exon            1522..1621
                     /gene="DDX4"
                     /inference="alignment:Splign:2.1.0"
     exon            1622..1892
                     /gene="DDX4"
                     /inference="alignment:Splign:2.1.0"
     exon            1893..1973
                     /gene="DDX4"
                     /inference="alignment:Splign:2.1.0"
     exon            1974..2948
                     /gene="DDX4"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      
gctatttggagcggagagtgaaagttacagttcctggtgctggtgggctgctggcattcgctatggaggaggactgggacacggagctggagcaggaggcggcagcggcttcccaggggcgttctgaggagcaggcgtggatggctaactctggcagaccaaacagcccatccctccgcttctccagcagaccaagcagccccttgtctggcttcccaggcagaccaaacagccccttctttggctttagtcagaataaaggctcacttggtgctaatgaaggacttaacagaagtctgcctgtgcagcatgacattggaggatattctgggagcagagagtctgttgtacgtccaaacagagaagatcaaccagtgactagatttggtagagggaggagttctggaagcagagattttcaagagaggaactctgcaaatgatcctggtatgcaagatcaaggttttagaagagttcctggcatctttgggcaaagcaagtgttttaacagtgaggaaagaaatagtcctctgcgtggcagcccttttgccccaggaggaagaggagcagttggaggtcctgcaggagttctcaaaggacgctctgaagaaattgattctggaagaggtccaaaggtgacttatgtcccccctcctccacctgaagatgaacagtccatctttgcatgttatcagtcaggaattaattttgacaagtatgatgaatgtgctgttgagatgtcaggacttgaccctccagcaccattactggcttttgaagaagctaactttgctcagactttaaggaagaatatatctaaaactggatattcaaaacttactccagtgcagaagcacagcattcctgttatacaagcagggcgggatttaatgtcatgtgcccagacaggatcaggaaaaacagcagcttttcttctaccaattgtggaccggatgatgaaagatggtgtaactgcaagtgccttccaaaagcagcaagaaccacaatgcattattgttgcaccaactagagaactgataaatcagatcttcttagaagcaaggaagtttgtgtatgggacttgtataaggcctgttgtgatctatggaggtacacagacaggtcattcaatccgtcaaataatgcaaggctgtaatatattatgtgccactcctggaaggcttcttgacattattgaaaaagggaagatcagtttggtggaggtgaaatatttggtactagatgaagcagaccgcatgctcgatatgggttttggattagatatgaagaagctgatttcttatccagaaatgccatctaaagacagacgtcaaacattaatgtttagtgccacttttcctgaggaagttcaaaggctggctggtgaatttttgaaaacagactatatatttcttgttattggaaatacctgtggagcctgcagtgatgttcagcaaaatattcttcaggttccccggttatccaagagggataaactaatagaaattctacaaagcacaggtggtgaacgaaccatggtgtttgtggacacaaagaaaaaagcagattaccttgcagcctttctttgtcaagagaacctaccatccaccagcattcatggagatagggaacagagagagagagagatagctcttcgcgatttccgttctggaaaatgtcaaattcttgtggcaacttcggtagcatcaagaggcctggatattgaaaatgttcaacatgttattaattttgatctccctaacaccattgaagattatgtacatcgaattggacgaactggtcgttgtggaaatactggcaaagcagtttcattctttgatgatcagtcagatggccatcttgtacaatctctacttaaagtgctttcagaagcccagcaggaagttccggtttggttggaagaaatggctgtccaaagaacaaatattgttgcttcacttggtgcccaaaggaataatgcaggccgtggcagaatgaacccaagagaaatgaggatgtcatattctgaaacaacatttaagtcatgggagtaaagcaaatttagcactaaactctgttgtattctgttgtggtttaagtgaactgttgcagttaatgtttaattactgttaagttttatgaaatgctttgtgtttacaagctaccttgtatctcatgatggcgctttcaacaatgaaaaaggaacccatcgttgattctcactcagtgtaggaaggcaaaagccattttcaggaaaaaaaagcctgaaactaagtgttaaatgtttcagtcagtaggtgtttactgatgcttatatgttactacaaataatgtgttgctataaaagagtgagttgtcatccctgttttgcttgcaagtggaaaatagcatatcacttgaacttaatactttgttattaaaattcagttaaattgcaacttggaagcagtgtatgtattcagtgccctggacagcatgactccttttcttgacaattttccgcaggatttgtgtatccattatgacttcaggtcagaagcttggggtcatcttgatttgctagctgtaggaaatacgtatgagtagtaatttctggagggagatgtacacttgaagtcttccgtgtctatgaaaagcaaccagagtaactgcagtcatgggtcatctgtatcctaagaaaaagccttcgaagggggctgacttatccttgtttcgaggatcacttcaatcacagggtgctttttgctttgcctcctgtcttatacctgtttggttggggagtatcaggatgagttgtgtaactgactaaagaggtattctggatctgttgtaggcttgcattttatttgtagcttgtaaaataattcttatcatagttttcctacatttcgtacatttcattgcgttctgtacaattcatcaaataaagcatctcaaatgttttctac
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]