LOCUS       NM_001285465            1991 bp    mRNA    linear   MAM 14-JUN-2023
DEFINITION  Sus scrofa cyclin dependent kinase 2 (CDK2), mRNA.
ACCESSION   NM_001285465 XM_003481615
VERSION     NM_001285465.1
KEYWORDS    RefSeq.
SOURCE      Sus scrofa (pig)
  ORGANISM  Sus scrofa
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Laurasiatheria; Artiodactyla; Suina; Suidae;
            Sus.
REFERENCE   1  (bases 1 to 1991)
  AUTHORS   Mulligan MK, Kleiman JE, Caldemeyer AC, Harding JCS and Pasternak
            JA.
  TITLE     Porcine reproductive and respiratory virus 2 infection of the fetus
            results in multi-organ cell cycle suppression
  JOURNAL   Vet Res 53 (1), 13 (2022)
   PUBMED   35189966
  REMARK    GeneRIF: Expression of CDK2 is down regulated in the heart, kidney,
            spleen, thymus and skeletal muscle of late gestation fetuses
            compromised by viral infection
            Publication Status: Online-Only
REFERENCE   2  (bases 1 to 1991)
  AUTHORS   Wang H and Kim NH.
  TITLE     CDK2 Is Required for the DNA Damage Response During Porcine Early
            Embryonic Development
  JOURNAL   Biol Reprod 95 (2), 31 (2016)
   PUBMED   27307074
  REMARK    GeneRIF: our results indicate that an ATM-P53-P21 DNA damage
            checkpoint is intact in the absence of CDK2; however, CDK2 is
            important for proper repair of the damaged DNA by either directly
            or indirectly influencing DNA repair-related gene expression.
REFERENCE   3  (bases 1 to 1991)
  AUTHORS   Tang Q, Li S, Zhang H, Wei Y, Wu H, Liu J, Wang Y, Liu D, Zhang Z
            and Liu C.
  TITLE     Correlation of the cyclin A expression level with porcine
            circovirus type 2 propagation efficiency
  JOURNAL   Arch Virol 158 (12), 2553-2560 (2013)
   PUBMED   23836398
REFERENCE   4  (bases 1 to 1991)
  AUTHORS   Sugiura K, Naito K and Tojo H.
  TITLE     Cdk2 activity is essential for the first to second meiosis
            transition in porcine oocytes
  JOURNAL   J Reprod Dev 51 (1), 143-149 (2005)
   PUBMED   15750306
REFERENCE   5  (bases 1 to 1991)
  AUTHORS   Uenishi H, Eguchi T, Suzuki K, Sawazaki T, Toki D, Shinkai H,
            Okumura N, Hamasima N and Awata T.
  TITLE     PEDE (Pig EST Data Explorer): construction of a database for ESTs
            derived from porcine full-length cDNA libraries
  JOURNAL   Nucleic Acids Res 32 (Database issue), D484-D488 (2004)
   PUBMED   14681463
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from JX967576.1.
            
            On Oct 27, 2013 this sequence version replaced XM_003481615.2.
            
            ##Evidence-Data-START##
            Transcript exon combination :: JX967576.1, SRR5250921.212417.1
                                           [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMEA103886111, SAMEA103886115
                                           [ECO:0000348]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-1991              JX967576.1         4-1994
FEATURES             Location/Qualifiers
     source          1..1991
                     /organism="Sus scrofa"
                     /mol_type="mRNA"
                     /db_xref="taxon:9823"
                     /chromosome="5"
                     /map="5"
     gene            1..1991
                     /gene="CDK2"
                     /note="cyclin dependent kinase 2"
                     /db_xref="GeneID:100154715"
                     /db_xref="VGNC:VGNC:111748"
     exon            1..254
                     /gene="CDK2"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    130..132
                     /gene="CDK2"
                     /note="upstream in-frame stop codon"
     CDS             139..1035
                     /gene="CDK2"
                     /note="porcine cyclin dependent kinase 2; cyclin-dependent
                     kinase-2 alpha"
                     /codon_start=1
                     /product="cyclin-dependent kinase 2"
                     /protein_id="NP_001272394.1"
                     /db_xref="GeneID:100154715"
                     /db_xref="VGNC:VGNC:111748"
                     /translation="

MENFQKVEKIGEGTYGVVYKAKNKVTGEVVALKKIRLDTETEGVPSTAIREISLLKELNHPNIVKLLDVIHTENKLYLVFEFLHQDLKKFMDASALTGIPLPLIKSYLFQLLQGLAFCHSHRVLHRDLKPQNLLINAEGSIKLADFGLARAFGVPVRTYTHEVVTLWYRAPEILLGCKYYSTAVDIWSLGCIFAEMVTRRALFPGDSEIDQLFRIFRTLGTPDEVVWPGVTSMPDYKPSFPKWARQDFSKVVPPLDEDGRSLLSQMLHYDPNKRISAKAALAHPFFQDVTKPVPHLRL"

     misc_feature    145..996
                     /gene="CDK2"
                     /note="Catalytic domain of the Serine/Threonine Kinases,
                     Cyclin-Dependent protein Kinase 2 and 3; Region:
                     STKc_CDK2_3; cd07860"
                     /db_xref="CDD:270844"
     misc_feature    order(166..177,190..192,229..231,235..237,286..288,
                     328..330,376..387,394..396,400..405,517..519,523..525,
                     529..534,538..540,571..573,580..582,616..618,622..633,
                     637..639,751..756)
                     /gene="CDK2"
                     /note="active site"
                     /db_xref="CDD:270844"
     misc_feature    order(166..177,190..192,229..231,235..237,328..330,
                     376..387,394..396,403..405,529..534,538..540,571..573)
                     /gene="CDK2"
                     /note="ATP binding site [chemical binding]; other site"
                     /db_xref="CDD:270844"
     misc_feature    order(247..249,259..270,274..276,283..288,292..297,
                     304..309,349..357,484..486,493..504,586..594,598..603,
                     607..618,952..954,964..972)
                     /gene="CDK2"
                     /note="CDK/cyclin interface [polypeptide binding]; other
                     site"
                     /db_xref="CDD:270844"
     misc_feature    order(286..288,400..402,517..519,523..525,580..582,
                     616..618,622..633,637..639,751..756)
                     /gene="CDK2"
                     /note="polypeptide substrate binding site [polypeptide
                     binding]; other site"
                     /db_xref="CDD:270844"
     misc_feature    568..639
                     /gene="CDK2"
                     /note="activation loop (A-loop); other site"
                     /db_xref="CDD:270844"
     exon            255..332
                     /gene="CDK2"
                     /inference="alignment:Splign:2.1.0"
     exon            333..453
                     /gene="CDK2"
                     /inference="alignment:Splign:2.1.0"
     exon            454..624
                     /gene="CDK2"
                     /inference="alignment:Splign:2.1.0"
     exon            625..726
                     /gene="CDK2"
                     /inference="alignment:Splign:2.1.0"
     exon            727..930
                     /gene="CDK2"
                     /inference="alignment:Splign:2.1.0"
     exon            931..1991
                     /gene="CDK2"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      

ctgcgttccatcccgacctggggccgccgtgcagggccctgtttccccctcctcggcccccgagagctgggtgccgctttctgctgggttcccaggcccccgctccagggccgggctgattcgactcgctagcgcttcatggagaacttccaaaaagtggaaaagatcggagagggcacgtacggagttgtgtacaaagccaaaaacaaggtgacgggagaagtggtggcgcttaaaaaaatccgcctggacactgagacggagggtgtacccagtactgccattcgagagatctctctgcttaaggagcttaaccaccctaatattgtcaagttgctggatgtcattcacacagaaaacaaactctacctggtttttgagtttctgcaccaggatctcaagaaattcatggatgcctctgctctcactggcattcctcttcccctcataaagagttatctgttccagctgcttcaggggctagctttttgccattctcatcgggtcttgcaccgagaccttaaacctcagaatctgcttatcaacgcagaaggatctatcaagttagcagactttggactggccagagcctttggagtccctgttcgtacatacacccatgaggtggtgactttgtggtacagagcacctgaaatccttctgggctgcaaatactactctacagccgtggacatctggagcctgggctgcatctttgctgagatggtgacccgccgggctctgttccctggagattctgagattgaccagctcttccggatctttcggactctcgggaccccagatgaggtggtttggccaggagttacttccatgcctgattataaaccgagtttccctaagtgggccaggcaagattttagcaaagttgtgcctcccctggatgaagatggacggagcttgttatcgcaaatgctgcactacgaccccaacaagcggatttcagcaaaggcagctctggctcaccctttcttccaggatgtgaccaagccagtacctcaccttcgactttgatggcctttgtgaaccctacccctcgtctcaccctctcctccagtgggggcctgatctggcttggcccagggcttttagcccactgttcttgtctggctgccttagcactcacctgctcctctcagccagccaactttggagaaacagggggtagaggggagcaataggtgaaattgaaaggaagcttcagtactagatgcacttaagtcagcctccaccaccctccccccctcctcttagtcgttacttatgagagctggtatttaaaaaaaacaaaaaaaaagactgactctttctcctcccaccacacagggattgccatccagtctctgaaagcccagaaattattttctgtgtttgggagaccccaaatctcctgcagccattgcgtaaagctaactgataacagcggggctaagttggaacttttgaaacccaagcaaaacagaaacatagggagggacctgttttaaagaattaggttaaaaaaatagatccaaccagtttatgccctagttgtagtgtttcatctcacctaacagtctgggagattcaagactcccagtctctgcggtgctagtgaggcggcagtagaaatggttgctcctagtcttcttgcctgtccctcctacaggcaagaggtgtctgggacgctctgggacaaagacaatgcttcactgaggccttaagaggcaagtgaaaaatgtttgaatttttctcttccttttaagagtcttagttcatcaggtgctaagtcctatcttcctctgaaggccaccctcataagagtgaaagttaaggtttagacatcgttttgagaatgctgacacttttttagggctgtgactgagtgggggcgttggggaaaaaatatttctttaaaagaaggatgaacaattatatttatatttcaggttatagtagttttttaagtgggaatgggtggatttgttgcc

//