ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2026-09-29 00:40:21, GGRNA.v2 : RefSeq release 233 (Jan, 2026)
LOCUS NM_001256558 1588 bp mRNA linear MAM 24-JAN-2024
DEFINITION Bos taurus acid phosphatase 5, tartrate resistant (ACP5), mRNA.
ACCESSION NM_001256558 XM_002688849 XM_595165
VERSION NM_001256558.1
KEYWORDS RefSeq.
SOURCE Bos taurus (domestic cattle)
ORGANISM Bos taurus
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Laurasiatheria; Artiodactyla; Ruminantia;
Pecora; Bovidae; Bovinae; Bos.
REFERENCE 1 (bases 1 to 1588)
AUTHORS Padua MB, Lynch VJ, Alvarez NV, Garthwaite MA, Golos TG, Bazer FW,
Kalkunte S, Sharma S, Wagner GP and Hansen PJ.
TITLE ACP5 (Uteroferrin): phylogeny of an ancient and conserved gene
expressed in the endometrium of mammals
JOURNAL Biol. Reprod. 86 (4), 123 (2012)
PUBMED 22278982
REMARK Publication Status: Online-Only
REFERENCE 2 (bases 1 to 1588)
AUTHORS Yamagishi N, Takehana K, Kim D, Miura M, Hirata T, Devkota B, Sato
S and Furuhama K.
TITLE Fluorometric method for measuring plasma tartrate-resistant acid
phosphatase isoform 5b and its application in cattle
JOURNAL J. Vet. Med. Sci. 71 (12), 1637-1642 (2009)
PUBMED 20046032
REMARK GeneRIF: This study reported a fluorometric method for measuring
tartrate-resistant acid phosphatase isoform 5b and reported on the
activity in the blood of cattle through development.
REFERENCE 3 (bases 1 to 1588)
AUTHORS Zimin AV, Delcher AL, Florea L, Kelley DR, Schatz MC, Puiu D,
Hanrahan F, Pertea G, Van Tassell CP, Sonstegard TS, Marcais G,
Roberts M, Subramanian P, Yorke JA and Salzberg SL.
TITLE A whole-genome assembly of the domestic cow, Bos taurus
JOURNAL Genome Biol. 10 (4), R42 (2009)
PUBMED 19393038
REFERENCE 4 (bases 1 to 1588)
AUTHORS Sato J, Sato R, Takagi A, Goto T, Okada K, Yasuda J and Naito Y.
TITLE Association between changes in plasma calcium concentration and
plasma tartrate-resistant acid phosphatase activity in
periparturient cows
JOURNAL J. Vet. Med. Sci. 65 (2), 291-293 (2003)
PUBMED 12655132
REMARK GeneRIF: Cows with a low tartrate-resistant acid phosphatase (TRAP)
activity are at risk of developing milk fever in comparison to cows
with high TRAP activity.
COMMENT VALIDATED REFSEQ: This record has undergone validation or
preliminary review. The reference sequence was derived from
EH160194.1, EV620769.1, EV620389.1, DY122872.1 and DN287520.1.
On or before Feb 10, 2012 this sequence version replaced
XM_595165.6, XM_002688849.2.
##Evidence-Data-START##
CDS exon combination :: JN635352.1 [ECO:0000331]
RNAseq introns :: single sample supports all introns
SAMN06299473, SAMN35038916 [ECO:0000348]
##Evidence-Data-END##
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-5 EH160194.1 2-6
6-735 EV620769.1 6-735
736-971 EV620389.1 532-767
972-1297 DY122872.1 47-372
1298-1588 DN287520.1 1-291 c
FEATURES Location/Qualifiers
source 1..1588
/organism="Bos taurus"
/mol_type="mRNA"
/db_xref="taxon:9913"
/chromosome="7"
/map="7"
/breed="Hereford"
gene 1..1588
/gene="ACP5"
/gene_synonym="TRAP"
/note="acid phosphatase 5, tartrate resistant"
/db_xref="BGD:BT10988"
/db_xref="GeneID:517002"
/db_xref="VGNC:VGNC:25556"
exon 1..121
/gene="ACP5"
/gene_synonym="TRAP"
/inference="alignment:Splign:2.1.0"
exon 122..209
/gene="ACP5"
/gene_synonym="TRAP"
/inference="alignment:Splign:2.1.0"
misc_feature 174..176
/gene="ACP5"
/gene_synonym="TRAP"
/note="upstream in-frame stop codon"
CDS 210..1241
/gene="ACP5"
/gene_synonym="TRAP"
/EC_number="3.1.3.2"
/note="uteroferrin; acid phosphatase type 5;
tartrate-resistant acid phosphatase"
/codon_start=1
/product="tartrate-resistant acid phosphatase type 5
precursor"
/protein_id="NP_001243487.1"
/db_xref="BGD:BT10988"
/db_xref="GeneID:517002"
/db_xref="VGNC:VGNC:25556"
/translation="
MDTWTVLLILQASLVLPRAAAAAAATTPAPMLRFVAVGDWGGVPNAPFYTAREMANAKEIARTVQILGADFVLSLGDNFYFSGVQDVNDKRFQETFEDVFSASPLRSVPWYVLAGNHDHLGNVSAQIAYSRVSKRWKFPSPYYRLRFKIPRSNVSVAIFMLDTVTLCGNSDDFASQQPERPRNLAMARTQLAWLKKQLAAAKEDYVLVAGHYPVWSIAEHGPTHCLVKQLLPLLNAHKVTAYLCGHDHNLQYLQDENGLGFVLSGAGNFMDPSKKHMRKVPNGYLRFHYGAENSLGGFAYVEISPKEMSVTYIEASGKSLFKTRLPRRARSEHQHRRGLHAGA"
sig_peptide 210..275
/gene="ACP5"
/gene_synonym="TRAP"
/inference="COORDINATES: ab initio prediction:SignalP:4.0"
misc_feature 303..1160
/gene="ACP5"
/gene_synonym="TRAP"
/note="Homo sapiens acid phosphatase 5 and related
proteins, metallophosphatase domain; Region: MPP_ACP5;
cd07378"
/db_xref="CDD:277324"
misc_feature order(324..326,438..440,447..449,555..557,840..842,
867..869,945..947,951..953)
/gene="ACP5"
/gene_synonym="TRAP"
/note="active site"
/db_xref="CDD:277324"
misc_feature order(324..326,438..440,447..449,555..557,840..842,
945..947,951..953)
/gene="ACP5"
/gene_synonym="TRAP"
/note="metal binding site [ion binding]; metal-binding
site"
/db_xref="CDD:277324"
misc_feature 573..575
/gene="ACP5"
/gene_synonym="TRAP"
/note="N-glycosylation site [posttranslational
modification]; other site"
/db_xref="CDD:277324"
exon 210..488
/gene="ACP5"
/gene_synonym="TRAP"
/inference="alignment:Splign:2.1.0"
exon 489..616
/gene="ACP5"
/gene_synonym="TRAP"
/inference="alignment:Splign:2.1.0"
exon 617..962
/gene="ACP5"
/gene_synonym="TRAP"
/inference="alignment:Splign:2.1.0"
exon 963..1583
/gene="ACP5"
/gene_synonym="TRAP"
/inference="alignment:Splign:2.1.0"
ORIGIN
acttcctgtttatctgggctatggggtcgggagttggcggggggcaagcagtcagcctgtgtcctcaagcctggggatgggagcccccattcaccgtcgcaagggcctgtagcgagccatcgaaataaaggctcggtgcccagccgctctgccctggagctcacctgcctctctgagcccctaggcaactggcttgtgcctcctccaggatggacacgtggacggtgctgctcatcctgcaagcctcgctggtgctcccccgggctgctgccgctgctgccgccaccacccccgcccccatgttgcgcttcgtcgctgtgggtgactggggaggggtccccaacgccccattctacacagcccgggaaatggccaatgccaaagagattgccaggacagtgcagatcctgggcgcagacttcgttctgtccctgggagacaatttctacttcagcggtgtgcaggatgtcaacgacaagaggtttcaggagaccttcgaggatgtgttctctgcctcgccgctccgctccgtgccctggtacgtgctggctggcaaccatgaccatctggggaacgtctcagcccagatcgcctactccagggtctccaagcgctggaagttccccagcccttactaccgcctgcgcttcaagatcccccggtccaacgtgtccgtggccatcttcatgctggacactgtgaccctgtgcggcaactctgacgactttgccagccagcagcccgagaggccccgcaacttggcgatggcccgcacgcagctggcctggctcaagaagcagctggcagcagccaaggaggactacgtgctggtggccggccactaccctgtgtggtctatcgccgagcatgggcccacccactgcctggtcaagcagctgctgccactgctgaacgcgcacaaggtcaccgcctacctgtgtggccatgaccacaacctgcagtaccttcaggatgagaatggcttgggcttcgtgttgagcggggctgggaacttcatggacccctcgaagaaacacatgcgcaaggtccccaacggctacctgcgcttccactacggggccgagaactcactgggtggcttcgcctacgtagagatcagccccaaggagatgagcgtcacttacattgaagcctcgggcaagtccctcttcaagaccaggttgccgaggcgagccaggtccgagcatcagcaccgccgcgggctccacgctggggcctgagtgagaaggcgcctccctgccggtgggtgggtgggtcccactgggacacacacacaccccctccctactccccctgcccatgggcaggctttctcaggagcccgtggtgtgatggcaaagcaggaaagagaagggcagatgaggaacttgtgacatagatgccgtgcctgaaagaaacatggacacatgtacgggccagagtgccaggccccgtgaccgggctcgcccagcctgagttccgggcattgaggggcaaggagggagggaggcagagctctcccctggatcaggcatccttctgtcactgctgaatagacaataaaggaaaaacttgcaaagactaaaaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]