GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2026-09-29 00:40:21, GGRNA.v2 : RefSeq release 233 (Jan, 2026)

LOCUS       NM_001256558            1588 bp    mRNA    linear   MAM 24-JAN-2024
DEFINITION  Bos taurus acid phosphatase 5, tartrate resistant (ACP5), mRNA.
ACCESSION   NM_001256558 XM_002688849 XM_595165
VERSION     NM_001256558.1
KEYWORDS    RefSeq.
SOURCE      Bos taurus (domestic cattle)
  ORGANISM  Bos taurus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Laurasiatheria; Artiodactyla; Ruminantia;
            Pecora; Bovidae; Bovinae; Bos.
REFERENCE   1  (bases 1 to 1588)
  AUTHORS   Padua MB, Lynch VJ, Alvarez NV, Garthwaite MA, Golos TG, Bazer FW,
            Kalkunte S, Sharma S, Wagner GP and Hansen PJ.
  TITLE     ACP5 (Uteroferrin): phylogeny of an ancient and conserved gene
            expressed in the endometrium of mammals
  JOURNAL   Biol. Reprod. 86 (4), 123 (2012)
   PUBMED   22278982
  REMARK    Publication Status: Online-Only
REFERENCE   2  (bases 1 to 1588)
  AUTHORS   Yamagishi N, Takehana K, Kim D, Miura M, Hirata T, Devkota B, Sato
            S and Furuhama K.
  TITLE     Fluorometric method for measuring plasma tartrate-resistant acid
            phosphatase isoform 5b and its application in cattle
  JOURNAL   J. Vet. Med. Sci. 71 (12), 1637-1642 (2009)
   PUBMED   20046032
  REMARK    GeneRIF: This study reported a fluorometric method for measuring
            tartrate-resistant acid phosphatase isoform 5b and reported on the
            activity in the blood of cattle through development.
REFERENCE   3  (bases 1 to 1588)
  AUTHORS   Zimin AV, Delcher AL, Florea L, Kelley DR, Schatz MC, Puiu D,
            Hanrahan F, Pertea G, Van Tassell CP, Sonstegard TS, Marcais G,
            Roberts M, Subramanian P, Yorke JA and Salzberg SL.
  TITLE     A whole-genome assembly of the domestic cow, Bos taurus
  JOURNAL   Genome Biol. 10 (4), R42 (2009)
   PUBMED   19393038
REFERENCE   4  (bases 1 to 1588)
  AUTHORS   Sato J, Sato R, Takagi A, Goto T, Okada K, Yasuda J and Naito Y.
  TITLE     Association between changes in plasma calcium concentration and
            plasma tartrate-resistant acid phosphatase activity in
            periparturient cows
  JOURNAL   J. Vet. Med. Sci. 65 (2), 291-293 (2003)
   PUBMED   12655132
  REMARK    GeneRIF: Cows with a low tartrate-resistant acid phosphatase (TRAP)
            activity are at risk of developing milk fever in comparison to cows
            with high TRAP activity.
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            EH160194.1, EV620769.1, EV620389.1, DY122872.1 and DN287520.1.
            
            On or before Feb 10, 2012 this sequence version replaced
            XM_595165.6, XM_002688849.2.
            
            ##Evidence-Data-START##
            CDS exon combination :: JN635352.1 [ECO:0000331]
            RNAseq introns       :: single sample supports all introns
                                    SAMN06299473, SAMN35038916 [ECO:0000348]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-5                 EH160194.1         2-6
            6-735               EV620769.1         6-735
            736-971             EV620389.1         532-767
            972-1297            DY122872.1         47-372
            1298-1588           DN287520.1         1-291               c
FEATURES             Location/Qualifiers
     source          1..1588
                     /organism="Bos taurus"
                     /mol_type="mRNA"
                     /db_xref="taxon:9913"
                     /chromosome="7"
                     /map="7"
                     /breed="Hereford"
     gene            1..1588
                     /gene="ACP5"
                     /gene_synonym="TRAP"
                     /note="acid phosphatase 5, tartrate resistant"
                     /db_xref="BGD:BT10988"
                     /db_xref="GeneID:517002"
                     /db_xref="VGNC:VGNC:25556"
     exon            1..121
                     /gene="ACP5"
                     /gene_synonym="TRAP"
                     /inference="alignment:Splign:2.1.0"
     exon            122..209
                     /gene="ACP5"
                     /gene_synonym="TRAP"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    174..176
                     /gene="ACP5"
                     /gene_synonym="TRAP"
                     /note="upstream in-frame stop codon"
     CDS             210..1241
                     /gene="ACP5"
                     /gene_synonym="TRAP"
                     /EC_number="3.1.3.2"
                     /note="uteroferrin; acid phosphatase type 5;
                     tartrate-resistant acid phosphatase"
                     /codon_start=1
                     /product="tartrate-resistant acid phosphatase type 5
                     precursor"
                     /protein_id="NP_001243487.1"
                     /db_xref="BGD:BT10988"
                     /db_xref="GeneID:517002"
                     /db_xref="VGNC:VGNC:25556"
                     /translation="
MDTWTVLLILQASLVLPRAAAAAAATTPAPMLRFVAVGDWGGVPNAPFYTAREMANAKEIARTVQILGADFVLSLGDNFYFSGVQDVNDKRFQETFEDVFSASPLRSVPWYVLAGNHDHLGNVSAQIAYSRVSKRWKFPSPYYRLRFKIPRSNVSVAIFMLDTVTLCGNSDDFASQQPERPRNLAMARTQLAWLKKQLAAAKEDYVLVAGHYPVWSIAEHGPTHCLVKQLLPLLNAHKVTAYLCGHDHNLQYLQDENGLGFVLSGAGNFMDPSKKHMRKVPNGYLRFHYGAENSLGGFAYVEISPKEMSVTYIEASGKSLFKTRLPRRARSEHQHRRGLHAGA"
     sig_peptide     210..275
                     /gene="ACP5"
                     /gene_synonym="TRAP"
                     /inference="COORDINATES: ab initio prediction:SignalP:4.0"
     misc_feature    303..1160
                     /gene="ACP5"
                     /gene_synonym="TRAP"
                     /note="Homo sapiens acid phosphatase 5 and related
                     proteins, metallophosphatase domain; Region: MPP_ACP5;
                     cd07378"
                     /db_xref="CDD:277324"
     misc_feature    order(324..326,438..440,447..449,555..557,840..842,
                     867..869,945..947,951..953)
                     /gene="ACP5"
                     /gene_synonym="TRAP"
                     /note="active site"
                     /db_xref="CDD:277324"
     misc_feature    order(324..326,438..440,447..449,555..557,840..842,
                     945..947,951..953)
                     /gene="ACP5"
                     /gene_synonym="TRAP"
                     /note="metal binding site [ion binding]; metal-binding
                     site"
                     /db_xref="CDD:277324"
     misc_feature    573..575
                     /gene="ACP5"
                     /gene_synonym="TRAP"
                     /note="N-glycosylation site [posttranslational
                     modification]; other site"
                     /db_xref="CDD:277324"
     exon            210..488
                     /gene="ACP5"
                     /gene_synonym="TRAP"
                     /inference="alignment:Splign:2.1.0"
     exon            489..616
                     /gene="ACP5"
                     /gene_synonym="TRAP"
                     /inference="alignment:Splign:2.1.0"
     exon            617..962
                     /gene="ACP5"
                     /gene_synonym="TRAP"
                     /inference="alignment:Splign:2.1.0"
     exon            963..1583
                     /gene="ACP5"
                     /gene_synonym="TRAP"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      
acttcctgtttatctgggctatggggtcgggagttggcggggggcaagcagtcagcctgtgtcctcaagcctggggatgggagcccccattcaccgtcgcaagggcctgtagcgagccatcgaaataaaggctcggtgcccagccgctctgccctggagctcacctgcctctctgagcccctaggcaactggcttgtgcctcctccaggatggacacgtggacggtgctgctcatcctgcaagcctcgctggtgctcccccgggctgctgccgctgctgccgccaccacccccgcccccatgttgcgcttcgtcgctgtgggtgactggggaggggtccccaacgccccattctacacagcccgggaaatggccaatgccaaagagattgccaggacagtgcagatcctgggcgcagacttcgttctgtccctgggagacaatttctacttcagcggtgtgcaggatgtcaacgacaagaggtttcaggagaccttcgaggatgtgttctctgcctcgccgctccgctccgtgccctggtacgtgctggctggcaaccatgaccatctggggaacgtctcagcccagatcgcctactccagggtctccaagcgctggaagttccccagcccttactaccgcctgcgcttcaagatcccccggtccaacgtgtccgtggccatcttcatgctggacactgtgaccctgtgcggcaactctgacgactttgccagccagcagcccgagaggccccgcaacttggcgatggcccgcacgcagctggcctggctcaagaagcagctggcagcagccaaggaggactacgtgctggtggccggccactaccctgtgtggtctatcgccgagcatgggcccacccactgcctggtcaagcagctgctgccactgctgaacgcgcacaaggtcaccgcctacctgtgtggccatgaccacaacctgcagtaccttcaggatgagaatggcttgggcttcgtgttgagcggggctgggaacttcatggacccctcgaagaaacacatgcgcaaggtccccaacggctacctgcgcttccactacggggccgagaactcactgggtggcttcgcctacgtagagatcagccccaaggagatgagcgtcacttacattgaagcctcgggcaagtccctcttcaagaccaggttgccgaggcgagccaggtccgagcatcagcaccgccgcgggctccacgctggggcctgagtgagaaggcgcctccctgccggtgggtgggtgggtcccactgggacacacacacaccccctccctactccccctgcccatgggcaggctttctcaggagcccgtggtgtgatggcaaagcaggaaagagaagggcagatgaggaacttgtgacatagatgccgtgcctgaaagaaacatggacacatgtacgggccagagtgccaggccccgtgaccgggctcgcccagcctgagttccgggcattgaggggcaaggagggagggaggcagagctctcccctggatcaggcatccttctgtcactgctgaatagacaataaaggaaaaacttgcaaagactaaaaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]