GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2026-09-29 00:40:34, GGRNA.v2 : RefSeq release 233 (Jan, 2026)

LOCUS       NM_001170768            2060 bp    mRNA    linear   MAM 01-JUL-2020
DEFINITION  Sus scrofa cyclin B1 (CCNB1), mRNA.
ACCESSION   NM_001170768
VERSION     NM_001170768.1
KEYWORDS    RefSeq.
SOURCE      Sus scrofa (pig)
  ORGANISM  Sus scrofa
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Laurasiatheria; Artiodactyla; Suina; Suidae;
            Sus.
REFERENCE   1  (bases 1 to 2060)
  AUTHORS   Liu H, Gao Y, Zhai B, Jiang H, Ding Y, Zhang L, Li C, Deng Q, Yu X
            and Zhang J.
  TITLE     The Effects of Polyadenylation Status on MPFs During In Vitro
            Porcine Oocyte Maturation
  JOURNAL   Cell. Physiol. Biochem. 39 (5), 1735-1745 (2016)
   PUBMED   27744448
  REMARK    GeneRIF: Cyclin B1 plays a significant role in promoting the
            maturation of large-follicle oocytes.
REFERENCE   2  (bases 1 to 2060)
  AUTHORS   Li S, Kang JD, Jin JX, Hong Y, Zhu HY, Jin L, Gao QS, Yan CG, Cui
            CD, Li WX and Yin XJ.
  TITLE     Effect of demecolcine-assisted enucleation on the MPF level and
            cyclin B1 distribution in porcine oocytes
  JOURNAL   PLoS ONE 9 (3), e91483 (2014)
   PUBMED   24626152
  REMARK    GeneRIF: cyclin B1 distribution in porcine oocytes is affected by
            demecolcine-assisted enucleation
            Publication Status: Online-Only
REFERENCE   3  (bases 1 to 2060)
  AUTHORS   Zhang DX, Cui XS and Kim NH.
  TITLE     Molecular characterization and polyadenylation-regulated expression
            of cyclin B1 and Cdc2 in porcine oocytes and early parthenotes
  JOURNAL   Mol. Reprod. Dev. 77 (1), 38-50 (2010)
   PUBMED   19705412
  REMARK    GeneRIF: Results describe the expression of maternal cyclin B1 and
            Cdc2 during in vitro maturation of porcine oocytes.
REFERENCE   4  (bases 1 to 2060)
  AUTHORS   Sugiura K, Naito K, Endo T and Tojo H.
  TITLE     Study of germinal vesicle requirement for the normal kinetics of
            maturation/M-phase-promoting factor activity during porcine oocyte
            maturation
  JOURNAL   Biol. Reprod. 74 (3), 593-600 (2006)
   PUBMED   16319287
  REMARK    GeneRIF: germinal vesicle is not required for the activation of M
            phase promoting factor during the first meiosis, but it is required
            for the second meiosis because of its promotion of CCNB1
            accumulation
            GeneRIF: germinal vesicles are not required for the activation of
            MPF during the first meiosis, but they are required for the second
            meiosis because of its promotion of CCNB1 accumulation.
REFERENCE   5  (bases 1 to 2060)
  AUTHORS   Anger M, Klima J, Kubelka M, Prochazka R, Motlik J and Schultz RM.
  TITLE     Timing of Plk1 and MPF activation during porcine oocyte maturation
  JOURNAL   Mol. Reprod. Dev. 69 (1), 11-16 (2004)
   PUBMED   15278898
REFERENCE   6  (bases 1 to 2060)
  AUTHORS   Uenishi H, Eguchi T, Suzuki K, Sawazaki T, Toki D, Shinkai H,
            Okumura N, Hamasima N and Awata T.
  TITLE     PEDE (Pig EST Data Explorer): construction of a database for ESTs
            derived from porcine full-length cDNA libraries
  JOURNAL   Nucleic Acids Res. 32 (Database issue), D484-D488 (2004)
   PUBMED   14681463
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from GQ184632.1.
            
            ##Evidence-Data-START##
            Transcript exon combination :: GQ184632.1, AK240474.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMN02584787 [ECO:0000348]
            ##Evidence-Data-END##
FEATURES             Location/Qualifiers
     source          1..2060
                     /organism="Sus scrofa"
                     /mol_type="mRNA"
                     /db_xref="taxon:9823"
                     /chromosome="16"
                     /map="16"
     gene            1..2060
                     /gene="CCNB1"
                     /note="cyclin B1"
                     /db_xref="GeneID:397662"
                     /db_xref="VGNC:VGNC:86349"
     exon            1..153
                     /gene="CCNB1"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    100..102
                     /gene="CCNB1"
                     /note="upstream in-frame stop codon"
     CDS             133..1440
                     /gene="CCNB1"
                     /note="cyclin B; G2/mitotic-specific cyclin B1"
                     /codon_start=1
                     /product="G2/mitotic-specific cyclin-B1"
                     /protein_id="NP_001164239.1"
                     /db_xref="GeneID:397662"
                     /db_xref="VGNC:VGNC:86349"
                     /translation="
MALRITRNTKINAENKAKISMAGAKRVPVASAATSKPGLRPRTALGDIGNKVSEQPQAKLPLKKEAKTLAAGKVVAKKLPKPLEKAPVPVLEPQPEREPEPELEPEPEPEPVKGEKLSPEPILVDTPSPSPMETSGCAPAEEYLCQAFSDVILAVNDVDAEDGGDPNLCSEYVKDIYDYLRQLEEEQAVRPKYLLGREVTGNMRAILIDWLVQVQMKFRLLQETMYMTVSIIDRFMQDNCVPKKMLQLVGVTAMFIASKYEEMYPPEIGDFAFVTDNTYTKYQIRQMEMKILRALNFCLGRPLPLHFLRRASKIGEVDVELHTLAKYLMELTMLDYDMVHFPPSQIAAGAFCLSLKILDNGEWTPTLQHYLSYTEESLLVVMQHLAKNIVVVNRGLTKHMTIKNKYATSKHAKISTLAQLNSALVQDLAKAVAKV"
     misc_feature    637..1023
                     /gene="CCNB1"
                     /note="first cyclin box found in G2/mitotic-specific
                     cyclin-B1 (CCNB1); Region: CYCLIN_CCNB1_rpt1; cd20565"
                     /db_xref="CDD:410268"
     misc_feature    order(643..648,655..660,667..672,679..681,895..900,
                     907..921,928..936,985..987,994..999,1006..1011,1018..1023)
                     /gene="CCNB1"
                     /note="CDK interface [polypeptide binding]; other site"
                     /db_xref="CDD:410268"
     misc_feature    1036..1398
                     /gene="CCNB1"
                     /note="Cyclin box fold superfamily; Region: CYCLIN_SF;
                     cl40454"
                     /db_xref="CDD:477360"
     exon            154..324
                     /gene="CCNB1"
                     /inference="alignment:Splign:2.1.0"
     exon            325..501
                     /gene="CCNB1"
                     /inference="alignment:Splign:2.1.0"
     exon            502..684
                     /gene="CCNB1"
                     /inference="alignment:Splign:2.1.0"
     exon            685..843
                     /gene="CCNB1"
                     /inference="alignment:Splign:2.1.0"
     exon            844..1080
                     /gene="CCNB1"
                     /inference="alignment:Splign:2.1.0"
     exon            1081..1221
                     /gene="CCNB1"
                     /inference="alignment:Splign:2.1.0"
     exon            1222..1332
                     /gene="CCNB1"
                     /inference="alignment:Splign:2.1.0"
     exon            1333..2045
                     /gene="CCNB1"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      
ccggattcctcccggcgtgctgcggaggaacggctgttagctagtggtggcttcaaggtccccggctggtcggggctccagtgctctgcttctcccctctgagctgctgcctggcctggtacagaggaagtcatggcgctccggatcaccaggaacacgaaaattaatgctgaaaataaggcgaagatcagtatggcaggcgcaaagcgcgtgcctgtggcctctgctgcaacctctaagcccggactgaggccaagaactgctcttggagacatcggtaacaaagtcagtgaacagccacaggccaaactgcctctgaaaaaggaagcaaaaactttagctgctggaaaagttgttgctaaaaaactaccgaaacctctggaaaaggctcctgtacctgtattagagccccagccagagagggagcccgagcctgaactggagcctgaaccagaacctgagcctgttaaaggagagaaactttcccctgaacctattttggttgatactccctctccaagccccatggaaacatctggctgtgcccctgcagaagaatatttgtgtcaggctttctctgatgtaattcttgcagtgaatgatgtggatgcagaagatggaggggatccaaacctttgtagtgaatatgtgaaagatatctatgattatctgagacaacttgaggaagaacaagcagttagaccaaaatacctactgggtcgtgaagtcactggaaacatgagagccatcctaattgactggctagtgcaggttcagatgaaattcaggttactacaggagaccatgtacatgacagtttccattattgatcggttcatgcaggataattgtgtgcccaagaagatgctccaactggttggtgtcactgccatgtttattgccagcaaatatgaagaaatgtaccctccagaaattggtgactttgcctttgtgactgacaatacttacactaagtaccaaatcaggcagatggaaatgaagattctaagagcattaaatttttgtctgggtcgccctctacccctgcattttcttcggagagcatccaagattggagaggttgatgttgagttacatactttggccaaatatctgatggagctaactatgttggactacgatatggtgcactttcctccttctcagatcgcagcaggagctttttgcctatccctgaagattcttgataatggtgaatggacaccaactctacagcattacctgtcatacactgaagaatcccttcttgtggttatgcaacacttggctaagaatatcgtcgtggtgaatcgagggcttacaaagcacatgactatcaagaacaagtatgccacatctaagcatgctaagatcagcactctagcccagctgaattcagcactagttcaagatttagccaaggctgtggcaaaggtgtaacttgtgaacttcggaatactataatatctacaaataaaattggcaccatgtgccatctgtacatattatatgttacacttatttacttttaataaagtttgtagtcctttttacttcttaactcatttgaatgtggctatttcccacttgaggataacttaaaagttgtcttaaaggtacagtggagaatgttttttaaaaaatgaaaactgttttcagttacctgggaacccaactaatatatacaattggctcttcttgttttatgtacttggcataacttaattaatatgagttcatatagtcttgaagccatttaatatctttatatgttacactgtatgtaagctcagtcatcttgagagaatctgctacctagttctacacaaggaagagtctaccgtctcaatcctagtccccttgttttatatttcctctggtggctgcagtcataatcctaaataatctacttgtaccactttcttaaattatcaactttagtatcaactttttcacttggaaaaatgagaattttaatttatattcaaaacctaatttactttttgtttattggttaagaaaaataaaacaatccttagaacaaaaaaacaaaaaaaaaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]