ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2026-06-17 19:05:24, GGRNA.v2 : RefSeq release 233 (Jan, 2026)
LOCUS NM_001025225 1218 bp mRNA linear MAM 02-APR-2025
DEFINITION Sus scrofa aurora kinase A (AURKA), mRNA.
ACCESSION NM_001025225
VERSION NM_001025225.1
KEYWORDS RefSeq.
SOURCE Sus scrofa (pig)
ORGANISM Sus scrofa
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Laurasiatheria; Artiodactyla; Suina; Suidae;
Sus.
REFERENCE 1 (bases 1 to 1218)
AUTHORS Komrskova,P., Susor,A., Malik,R., Prochazkova,B., Liskova,L.,
Supolikova,J., Hladky,S. and Kubelka,M.
TITLE Aurora kinase A is not involved in CPEB1 phosphorylation and cyclin
B1 mRNA polyadenylation during meiotic maturation of porcine
oocytes
JOURNAL PLoS One 9 (7), e101222 (2014)
PUBMED 24983972
REMARK GeneRIF: Aurora kinase A is unlikely to be involved in CPEB1
activating phosphorylation and cyclin B1 mRNA polyadenylation
during meiotic maturation of porcine oocytes.
Publication Status: Online-Only
REFERENCE 2 (bases 1 to 1218)
AUTHORS Nishimura,Y., Kano,K. and Naito,K.
TITLE Porcine CPEB1 is involved in Cyclin B translation and meiotic
resumption in porcine oocytes
JOURNAL Anim Sci J 81 (4), 444-452 (2010)
PUBMED 20662813
REFERENCE 3 (bases 1 to 1218)
AUTHORS Nishimura,Y., Endo,T., Kano,K. and Naito,K.
TITLE Porcine Aurora A accelerates Cyclin B and Mos synthesis and
promotes meiotic resumption of porcine oocytes
JOURNAL Anim Reprod Sci 113 (1-4), 114-124 (2009)
PUBMED 18614302
REMARK GeneRIF: Aurora A stimulates the protein synthesis and promotes the
meiotic resumption.
REFERENCE 4 (bases 1 to 1218)
AUTHORS Yao,L.J. and Sun,Q.Y.
TITLE Characterization of aurora-a in porcine oocytes and early embryos
implies its functional roles in the regulation of meiotic
maturation, fertilization and cleavage
JOURNAL Zygote 13 (1), 23-30 (2005)
PUBMED 15984158
REMARK GeneRIF: Aurora-A may be a multifunctional kinase that plays
pivotal regulatory roles in microtubule assembly during porcine
oocyte meiotic maturation, fertilization and early embryonic
mitosis
COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final
NCBI review. The reference sequence was derived from AB196773.1.
##Evidence-Data-START##
Transcript exon combination :: AB196773.1, SRR5120059.330090.1
[ECO:0000332]
RNAseq introns :: mixed/partial sample support
SAMEA103886111, SAMEA103886112
[ECO:0000350]
##Evidence-Data-END##
FEATURES Location/Qualifiers
source 1..1218
/organism="Sus scrofa"
/mol_type="mRNA"
/db_xref="taxon:9823"
/chromosome="17"
/map="17"
gene 1..1218
/gene="AURKA"
/gene_synonym="ARK-1; STK6"
/note="aurora kinase A"
/db_xref="GeneID:574063"
/db_xref="RGD:13867865"
CDS 1..1218
/gene="AURKA"
/gene_synonym="ARK-1; STK6"
/EC_number="2.7.11.1"
/note="serine/threonine kinase 6; aurora-A;
Serine/threonine-protein kinase 6;
serine/threonine-protein kinase aurora-A; aurora 2;
aurora-related kinase 1; aurora/IPL1-related kinase 1;
serine/threonine-protein kinase 15; ipl1- and
aurora-related kinase 1; serine/threonine-protein kinase
Ayk1"
/codon_start=1
/product="aurora kinase A"
/protein_id="NP_001020396.1"
/db_xref="GeneID:574063"
/db_xref="RGD:13867865"
/translation="
MDKCKENCISGLKTTVPPGDGPKRVPVTQHFPAQHLPSANSGQAQRVLCPSNSSQRLPSHTQKLVSSHKPVQNLKQKQSQATSGPRPVSRPLSNTQQSEQPQPAAPGNNPEKEAASKQKNEESKKRQWALEDFEIGRPLGKGKFGNVYLAREKQSKFILALKVLFKTQLEKAGVEHQLRREVEIQSHLRHPNILRLYGYFHDATRVYLILEYAPLGAVYRELRELQKLSKFDEQRTATYITELANALSYCHSKRVIHRDIKPENLLLGSAGELKIADFGWSVHAPSSRRTTLCGTLDYLPPEMIEGRMHDEKVDLWSLGVLCYEFLVGKPPFEANTYQETYKRISRVEFTFPDFAPEGARDLISRLLKHNPSHRPTLKEVLEHPWITANSKPASSHKKESTSKQP"
misc_feature 1..375
/gene="AURKA"
/gene_synonym="ARK-1; STK6"
/note="propagated from UniProtKB/Swiss-Prot (A5GFW1.1);
Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
misc_feature 121..123
/gene="AURKA"
/gene_synonym="ARK-1; STK6"
/note="Phosphoserine.
/evidence=ECO:0000250|UniProtKB:O14965; propagated from
UniProtKB/Swiss-Prot (A5GFW1.1); phosphorylation site"
misc_feature 151..153
/gene="AURKA"
/gene_synonym="ARK-1; STK6"
/note="Phosphoserine.
/evidence=ECO:0000250|UniProtKB:O14965; propagated from
UniProtKB/Swiss-Prot (A5GFW1.1); phosphorylation site"
misc_feature 379..1161
/gene="AURKA"
/gene_synonym="ARK-1; STK6"
/note="The protein kinase superfamily is mainly composed
of the catalytic domains of serine/threonine-specific and
tyrosine-specific protein kinases. It also includes RIO
kinases, which are atypical serine protein kinases,
aminoglycoside phosphotransferases; Region: Protein
Kinases, catalytic domain; cl21453"
/db_xref="CDD:473864"
misc_feature order(415..426,433..435,439..441,478..480,484..486,
580..582,628..639,775..777,787..792,796..798,826..831)
/gene="AURKA"
/gene_synonym="ARK-1; STK6"
/note="ATP binding site [chemical binding]; other site"
/db_xref="CDD:271018"
misc_feature 847..888
/gene="AURKA"
/gene_synonym="ARK-1; STK6"
/note="propagated from UniProtKB/Swiss-Prot (A5GFW1.1);
Region: Activation segment.
/evidence=ECO:0000250|UniProtKB:O14965"
misc_feature 868..870
/gene="AURKA"
/gene_synonym="ARK-1; STK6"
/note="Phosphothreonine.
/evidence=ECO:0000250|UniProtKB:O14965; propagated from
UniProtKB/Swiss-Prot (A5GFW1.1); phosphorylation site"
misc_feature 871..873
/gene="AURKA"
/gene_synonym="ARK-1; STK6"
/note="Phosphothreonine.
/evidence=ECO:0000250|UniProtKB:O14965; propagated from
UniProtKB/Swiss-Prot (A5GFW1.1); phosphorylation site"
misc_feature 1033..1035
/gene="AURKA"
/gene_synonym="ARK-1; STK6"
/note="Phosphoserine, by PKA and PAK.
/evidence=ECO:0000250|UniProtKB:O14965; propagated from
UniProtKB/Swiss-Prot (A5GFW1.1); phosphorylation site"
exon 1..39
/gene="AURKA"
/gene_synonym="ARK-1; STK6"
/inference="alignment:Splign:2.1.0"
exon 40..319
/gene="AURKA"
/gene_synonym="ARK-1; STK6"
/inference="alignment:Splign:2.1.0"
exon 320..374
/gene="AURKA"
/gene_synonym="ARK-1; STK6"
/inference="alignment:Splign:2.1.0"
exon 375..566
/gene="AURKA"
/gene_synonym="ARK-1; STK6"
/inference="alignment:Splign:2.1.0"
exon 567..714
/gene="AURKA"
/gene_synonym="ARK-1; STK6"
/inference="alignment:Splign:2.1.0"
exon 715..863
/gene="AURKA"
/gene_synonym="ARK-1; STK6"
/inference="alignment:Splign:2.1.0"
exon 864..1038
/gene="AURKA"
/gene_synonym="ARK-1; STK6"
/inference="alignment:Splign:2.1.0"
exon 1039..1218
/gene="AURKA"
/gene_synonym="ARK-1; STK6"
/inference="alignment:Splign:2.1.0"
ORIGIN
atggacaaatgtaaagaaaactgcatttcggggcttaagaccacagttccacctggcgatggtccaaaacgggttccagtgacccagcactttccagctcagcatctgccgtctgcaaacagcggccaggcccagcgggtcttatgtccttcgaattcctcacagcgcctgccttcgcacacgcagaagctcgtctccagccataaaccagttcagaatctgaagcagaagcagtcgcaggcaaccagtggccctcgtcctgtctccaggcctctgagtaacacccagcagagtgagcagccccagccggcagcgcctggaaacaatcctgaaaaggaagcggcatcaaaacagaaaaatgaagaatcaaaaaaaaggcaatgggctttggaagattttgaaattggccgcccgctgggtaaaggaaagtttggtaatgtttatttagcaagagaaaaacaaagcaagtttatcctggctcttaaagtattgtttaaaactcagctggagaaggcaggagttgagcatcagctgagaagagaagtagaaatacagtcccaccttaggcatccaaatattctcagactgtatggttatttccatgacgctaccagagtttacctaatcctggaatacgcacctctcggagctgtctatagagaacttagagaacttcagaaactgtcaaagtttgatgagcagagaactgctacttatatcacagaattggcaaatgccctatcttactgtcactcaaagagagttattcacagagacattaagccagagaacctgctccttggatccgctggagagcttaagattgccgattttgggtggtcggtccatgccccgtcctccaggagaaccaccctctgcggcaccctggactacttgccccccgagatgatcgaaggccggatgcatgacgagaaggtggatctctggagcttgggggtgctttgctatgaattcctggttgggaagcccccctttgaggcaaacacgtaccaagagacctacaaaaggatatcccgggtggaattcaccttccctgactttgcgcccgagggagccagggacctcatctcaagactattgaagcacaaccccagccacaggcccaccctcaaggaggtgctcgaacacccctggatcaccgccaattccaagccagcaagtagtcacaaaaaagaatccaccagcaagcaaccctaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]