GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2026-06-17 16:23:12, GGRNA.v2 : RefSeq release 233 (Jan, 2026)

LOCUS       XR_012040677             451 bp    RNA     linear   VRT 03-APR-2025
DEFINITION  PREDICTED: Ciconia boyciana uncharacterized lncRNA (LOC140647122),
            ncRNA.
ACCESSION   XR_012040677
VERSION     XR_012040677.1
DBLINK      BioProject: PRJNA1244888
KEYWORDS    RefSeq.
SOURCE      Ciconia boyciana (Oriental stork)
  ORGANISM  Ciconia boyciana
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
            Coelurosauria; Aves; Neognathae; Neoaves; Aequornithes;
            Ciconiiformes; Ciconiidae; Ciconia.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_132935) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Full annotation
            Annotation Name             :: GCF_034638445.1-RS_2025_04
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.3
            Annotation Method           :: Gnomon; cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 04/02/2025
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..451
                     /organism="Ciconia boyciana"
                     /mol_type="transcribed RNA"
                     /db_xref="taxon:52775"
                     /chromosome="2"
     gene            1..451
                     /gene="LOC140647122"
                     /note="uncharacterized LOC140647122; Derived by automated
                     computational analysis using gene prediction method:
                     Gnomon."
                     /db_xref="GeneID:140647122"
     ncRNA           1..451
                     /ncRNA_class="lncRNA"
                     /gene="LOC140647122"
                     /product="uncharacterized lncRNA"
                     /db_xref="GeneID:140647122"
ORIGIN      
gaccacaggacagtcaggaagaaaaagtgaaatattttattcactcatggggccaaacttgcttaatgcctgccaagccttcaccaagaaaggaattgccaacagcctctagagttagaatggaatatgacagcactttatgcatgtaaaagacccagagttcatgctttactgagcagaaaccagcaatctcttcttgcctctacctctccttctacttttgatgtgttttttccgtgctgtggaaactcgtgcagaattgttatgccagttggacagaattttatagccaaaagttcaaccctgctgtttggctctatggactccacaccgtcgtcattcacgcaggcactgccaatgactcatcaaagatgatgtcccagatgtccctcttcttcccctgccaagcttgccaaatacctctttggcatgccacccaaaggacagaagc
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]