ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2026-06-17 16:21:32, GGRNA.v2 : RefSeq release 233 (Jan, 2026)
LOCUS XM_067333811 2622 bp mRNA linear INV 15-AUG-2024 DEFINITION Trypanosoma melophagium PAZ domain (LSM04_001192), partial mRNA. ACCESSION XM_067333811 VERSION XM_067333811.1 DBLINK BioProject: PRJNA1147289 BioSample: SAMN23701209 KEYWORDS RefSeq. SOURCE Trypanosoma melophagium ORGANISM Trypanosoma melophagium Eukaryota; Discoba; Euglenozoa; Kinetoplastea; Metakinetoplastina; Trypanosomatida; Trypanosomatidae; Trypanosoma; Megatrypanum. REFERENCE 1 (bases 1 to 2622) AUTHORS Oldrieve,G.R., Malacart,B., Lopez-Vidal,J. and Matthews,K.R. TITLE The genomic basis of host and vector specificity in non-pathogenic trypanosomatids JOURNAL Biol Open (2022) In press REMARK DOI: 10.1242/bio.059237 REFERENCE 2 (bases 1 to 2622) CONSRTM NCBI Genome Project TITLE Direct Submission JOURNAL Submitted (15-AUG-2024) National Center for Biotechnology Information, NIH, Bethesda, MD 20894, USA REFERENCE 3 (bases 1 to 2622) AUTHORS Oldrieve,G.R. TITLE Direct Submission JOURNAL Submitted (11-JAN-2022) Institute for Immunology and Infection Research, University of Edinburgh, Charlotte Auerbach Road, Edinburgh, Midlothian EH9 3FL, United Kingdom COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. This record is derived from an annotated genomic sequence (NW_027125191). COMPLETENESS: incomplete on both ends. FEATURES Location/Qualifiers source 1..2622 /organism="Trypanosoma melophagium" /mol_type="mRNA" /isolate="St. Kilda" /isolation_source="blood" /host="Ovis aries" /db_xref="taxon:715481" /chromosome="Unknown" /ecotype="St. Kilda" /geo_loc_name="United Kingdom: Scotland, St. Kilda" /lat_lon="57.8287 N 8.6352 W" /collection_date="2020-09-17" gene <1..>2622 /locus_tag="LSM04_001192" /db_xref="GeneID:92523055" CDS 1..2622 /locus_tag="LSM04_001192" /codon_start=1 /product="PAZ domain" /protein_id="XP_067186217.1" /db_xref="GeneID:92523055" /translation="
MSADRGGERGGRGGRGGGGGRGGRGGGERGSRGGGGGGRGGRGGGFFLGDSHKNQSREKDAIMEFAEKTYSCPLEAYSNLFPLNIDTKKHIYINTVSYEMKGGAVDLQDRLKIKACVELLKKMKKEIGNQNSFDFEICVCTGQFILSPQQLPIEEYSFDFEVKGKRGKATQFYQLTIAKRESIVLDIDKHRTEINSIIGKAVKTCYREKLGEKYVDINGNGTTVGGKIATFDGVIPKVLATTIKGNKKTVLQIDISVTVVSTRNCLLVMEDLKRSGSRNFERLLSERFLKKKLCTVYGGSRGSIYTVTGISTTKAKDVARIKGNPEQTYVQYFAQRYRIHINPDQILFECKTSSGKKVLIPPEVLYDLSIDEQDRRLLPLLCSVYPNDRKSRVSEVLRRLKTEENGAAIDILKKYGITFSDEAFLVSGHVLGPVEILIPQGNGYKSVKTLGENNQQGFLKELQVLRHPGNRRSLDVAIYDDTNRGEIVLSVIKKNLDSINAPVQLKNIHRLDNVRAAKGLSYKEMMGFAFFRQHEKENYQSLKSIWTTEGIFSQMIVKDLTGYREASIVKAVAQQVSAKNGNLNWVLDLQKCCPSLTKKMSGGSGALVIAGDVGRDQINIRSENLTTRESIYTVAFVAFFVRGKEWMTYCNHYHVNGRKETIFSTAPDTESSRHSGGSLLPSEVLSIKMEEFIKDALRHFKQKGFQVSAVVFLRGCASEGELINARQHDIDFLSGYFKDNVAWAAVAAQRYVHTRFSAPTPKDHSFLCNVPRGFVTEEGTDNRFGESFFLTGANCTLGHARSTLYVIFGRKDNFELRELQSLIYGMGFLYPNKTDGLPLPLPLKCASEYARKYVPLRNVKALPDSLRTSMHYL"
misc_feature 793..1179
/locus_tag="LSM04_001192"
/note="PAZ domain, named PAZ after the proteins Piwi
Argonaut and Zwille. PAZ is found in two families of
proteins that are essential components of RNA-mediated
gene-silencing pathways, including RNA interference, the
piwi and Dicer families. PAZ functions as a...; Region:
PAZ; cl00301"
/db_xref="CDD:469713"
misc_feature order(913..915,985..987,997..999,1048..1050,1072..1074,
1078..1080)
/locus_tag="LSM04_001192"
/note="nucleic acid-binding interface [nucleotide
binding]; other site"
/db_xref="CDD:239207"
misc_feature 1600..2553
/locus_tag="LSM04_001192"
/note="PIWI domain. Domain found in proteins involved in
RNA silencing. RNA silencing refers to a group of related
gene-silencing mechanisms mediated by short RNA molecules,
including siRNAs, miRNAs, and heterochromatin-related
guide RNAs. The central component...; Region: Piwi-like;
cl00628"
/db_xref="CDD:412485"
misc_feature order(1615..1617,1627..1629,1660..1671,1681..1683,
1702..1704,1711..1713,1723..1725,1735..1737)
/locus_tag="LSM04_001192"
/note="5' RNA guide strand anchoring site [active]"
/db_xref="CDD:239208"
misc_feature order(1834..1836,1840..1842,2143..2145,2551..2553)
/locus_tag="LSM04_001192"
/note="active site"
/db_xref="CDD:239208"
ORIGIN
atgagtgcagatcggggaggagaacgtggaggccgcggtggtcgtggtggtggaggaggacgtggaggccgaggaggcggtgaacgtggtagtcgtggtggaggaggaggaggacgtggaggccgaggaggaggattttttttgggtgattcccataagaatcaatcgagagaaaaagacgcgatcatggaatttgcagagaaaacgtatagttgcccattggaggcttattcaaatcttttccccttgaatattgatacgaaaaagcatatttacattaatactgtttcgtatgaaatgaaaggaggtgctgtcgatcttcaagatcgattaaagataaaagcttgcgtagaacttttaaaaaagatgaaaaaagaaattgggaatcaaaattcatttgactttgaaatatgcgtctgtacgggacaatttatactctcccctcaacaacttcccattgaagaatattcgtttgattttgaagtcaagggaaagaggggtaaagcaacgcagttttatcaactaacaattgctaaaagagaatcaattgtactggatattgacaaacacagaactgaaatcaatagtattattggaaaagcagtgaaaacatgttacagggaaaaattaggagaaaaatatgtggatataaatgggaatggaaccactgttggtggcaaaattgccacttttgatggggttattcctaaggtgcttgcaaccactataaagggtaataaaaaaaccgtactacaaattgatatttctgtcactgtagtttctacacgaaattgtctactggtgatggaagaccttaagagaagtggttcaagaaattttgagagattactaagtgaaagatttttaaaaaaaaaactttgtacggtttatggcggatcaagaggaagcatatatactgttacaggaatcagcacgacaaaagcaaaagatgttgccagaataaaaggaaaccctgaacaaacatatgttcaatattttgcacaacgctaccgaatacatataaaccctgatcaaatattatttgagtgcaaaacttcttcaggtaaaaaggtccttataccacctgaggttttgtacgatttatctattgatgaacaagacagacgtctactgcctttattatgctctgtctatccaaatgatagaaaaagccgtgtgagtgaagttttaagacgacttaagactgaagaaaatggtgccgcgatagatatactaaagaaatacggcattacattttcggatgaagcatttttggtcagtggccatgttctgggtcctgtggaaatactcattccacaaggtaatggatataagagtgtaaaaacacttggtgaaaataatcagcaaggcttcctaaaggaattacaagttttacgacatcccgggaatcgccgttctttggatgtcgcaatctatgatgacacaaaccgcggtgaaattgtcttgagcgttatcaagaaaaatcttgattctataaatgctccggtgcaattgaaaaacatacatcgtttggacaatgtcagggctgctaaaggcctttcgtataaagaaatgatgggctttgctttttttcgacaacatgaaaaagaaaattatcaatctctaaagtcaatatggacgaccgaaggaatattcagccaaatgatcgtgaaagacttaacaggatatagagaggcatctatagtaaaggcagtagctcaacaagtttctgcaaaaaatggaaatttaaactgggttttggatcttcagaaatgttgcccttcactaactaaaaaaatgtctggaggcagtggagcactggtgattgcaggggacgttggaagggatcaaataaacattagatcggaaaatttaacaacaagagaatcaatttatacagttgcttttgttgctttttttgtgcgcggtaaagaatggatgacgtactgtaatcattatcatgttaacggaagaaaagaaacaattttttcaactgcccctgatactgaaagttcacgtcattctggagggagtttacttccatcagaagtactttctataaaaatggaagaatttataaaagatgcactaagacacttcaagcaaaaaggtttccaggtttcagccgttgtatttttgcgtggctgtgcatctgaaggtgagctaataaatgccagacaacatgatattgattttttaagtggttatttcaaagacaacgtcgcatgggctgctgtagcagcgcaacgttatgtacacacccgttttagcgcaccaacaccaaaagatcattcctttttatgtaatgttccacggggttttgtgacagaggaaggaacagataacagatttggtgaatctttctttctaaccggagcaaattgtactcttggtcatgcacgttccacgttgtacgttatttttggaaggaaagacaactttgaactacgtgaattgcagagcctcatttatgggatggggtttctttaccccaataaaaccgatgggttaccacttccacttccgctgaagtgtgcatccgaatacgcaagaaaatatgttcccctgcgaaatgtaaaagcactgccagattctttgcgaacaagtatgcactatctgtag
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]