ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2026-09-30 01:45:56, GGRNA.v2 : RefSeq release 233 (Jan, 2026)
LOCUS XM_050281915 1438 bp mRNA linear PLN 25-AUG-2022 DEFINITION PREDICTED: Malus sylvestris protein argonaute MEL1-like (LOC126614318), transcript variant X5, mRNA. ACCESSION XM_050281915 VERSION XM_050281915.1 DBLINK BioProject: PRJNA824043 KEYWORDS RefSeq. SOURCE Malus sylvestris (European crab apple) ORGANISM Malus sylvestris Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliopsida; eudicotyledons; Gunneridae; Pentapetalae; rosids; fabids; Rosales; Rosaceae; Amygdaloideae; Maleae; Malus. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_062262) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI RefSeq Annotation Status :: Full annotation Annotation Name :: Malus sylvestris Annotation Release 100 Annotation Version :: 100 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 10.0 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..1438 /organism="Malus sylvestris" /mol_type="mRNA" /db_xref="taxon:3752" /chromosome="3" gene 1..1438 /gene="LOC126614318" /note="protein argonaute MEL1-like; Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 2 long SRA reads, 1 Protein" /db_xref="GeneID:126614318" CDS 407..1270 /gene="LOC126614318" /codon_start=1 /product="protein argonaute MEL1-like isoform X4" /protein_id="XP_050137872.1" /db_xref="GeneID:126614318" /translation="
MVTEFVKKLLSNRQLSRPLPDRDRLKEKKPLKGVKVPLSYEEHTGYEITRVSVEPQSKLKFTHERYNIGLRDVATPALQTGRDSKPVYLPMEVPVQMVKHNGHNKDEVIQREIGMTIREDMTLVNARVLWPPLKMFNGVQVDFWAYVDFSLLDQSFNFRFCEDLVRPCNSKGVHFHPQPLLLHQSAHPGKIERVLGDIHKMSGKQLEEVGQKGRHLQLLIIILPDVTGLYEKMIKRFRESELGVVSQCCQPTAASRLSKQYLENLSLEISEVWWKEHCCHSKKDSSS"
misc_feature 410..685
/gene="LOC126614318"
/note="PAZ domain, argonaute_like subfamily. Argonaute is
part of the RNA-induced silencing complex (RISC), and is
an endonuclease that plays a key role in the RNA
interference pathway. The PAZ domain has been named after
the proteins Piwi,Argonaut, and Zwille; Region:
PAZ_argonaute_like; cd02846"
/db_xref="CDD:239212"
misc_feature 737..>1213
/gene="LOC126614318"
/note="PIWI domain. Domain found in proteins involved in
RNA silencing. RNA silencing refers to a group of related
gene-silencing mechanisms mediated by short RNA molecules,
including siRNAs, miRNAs, and heterochromatin-related
guide RNAs. The central component...; Region: Piwi-like;
cl00628"
/db_xref="CDD:412485"
misc_feature order(1094..1096,1109..1111,1145..1156,1160..1162,
1187..1189,1196..1198,1208..1210)
/gene="LOC126614318"
/note="5' RNA guide strand anchoring site [active]"
/db_xref="CDD:239208"
ORIGIN
taatagttgtttgctcttcattatcgtttggaatcagaaaggggttttgagaaactcaaatgatttttgggtcccaaaacgccatgagtgactacagtttcaaaaaaccgaagaataaaaactaaaaaaaaaggcaaaagaaaaattcagaaaataaaatacaaatttttaatttaaatttggaaagggaaacctgaacagtacaaatgcagatgcacatataaacacagaaaaataagaacaaaaggaacactgcagaaagaaagaaagggaggaaactcaagtgctggatgttgctctgaaggccgcacctccataaaagtactcgtctttcgccactgagcttgggcagaaaggtggtgatcttggtgaagatgtattggccagagcaatttataagcctattatggtaactgagtttgtcaaaaaacttttgagcaacagacaactgtccaggcctttgcctgatcgtgatcgtttgaaggagaaaaagcccttaaagggggtcaaggtaccgctttcttatgaagagcataccggttatgaaatcactagggtgtcagttgaaccacagagcaagttgaagttcactcatgagaggtacaatattgggctaagggatgtggcaacgcctgcgcttcaaactgggagggattcaaaacctgtttatttgccaatggaggtacctgtacagatggttaaacacaatggtcacaataaagatgaggttatccaacgggaaattggaatgactataagagaagatatgactttagttaatgctcgtgttctgtggccgcctttgaaaatgtttaacggtgttcaagtggatttctgggcatatgttgatttttccctattggaccaaagttttaacttccgattctgtgaggatttggtccgtccgtgcaacagcaagggagtgcatttccatccgcaacctttacttctgcatcaatcagctcatcctgggaaaatagagagggtgctcggagatatccataagatgtctggcaagcaacttgaagaagttggacagaagggaaggcatcttcagttgttaattatcattttgcctgatgtcactggattatatgaaaagatgataaaacgattccgggaaagtgagttaggagtcgtatctcagtgctgtcagcctacagcagcatcgaggctcagcaaacaatatttagaaaatttgtcgctcgagataagtgaagtttggtggaaggaacactgttgccattcgaagaaggattcctctagttagtgacatccccacaatcatctttgctgcggatgttacccatcctcaacctgggaaggacagcagtctgtcaattgcagctgtggtggcgtcaatagattggccacagataatccaagatctttatagtgtaaaccaggatcctaacaatggtcttgttggaggaggaat
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]