GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2026-09-30 01:45:54, GGRNA.v2 : RefSeq release 233 (Jan, 2026)

LOCUS       XM_042382706            1065 bp    mRNA    linear   INV 16-JUL-2021
DEFINITION  PREDICTED: Homarus americanus protein argonaute-1-like
            (LOC121877077), partial mRNA.
ACCESSION   XM_042382706
VERSION     XM_042382706.1
DBLINK      BioProject: PRJNA744898
KEYWORDS    RefSeq.
SOURCE      Homarus americanus (American lobster)
  ORGANISM  Homarus americanus
            Eukaryota; Metazoa; Ecdysozoa; Arthropoda; Crustacea;
            Multicrustacea; Malacostraca; Eumalacostraca; Eucarida; Decapoda;
            Pleocyemata; Astacidea; Nephropoidea; Nephropidae; Homarus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_024742915.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Homarus americanus Annotation
                                           Release 100
            Annotation Version          :: 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 9.0
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
            COMPLETENESS: incomplete on the 3' end.
FEATURES             Location/Qualifiers
     source          1..1065
                     /organism="Homarus americanus"
                     /mol_type="mRNA"
                     /isolate="GMGI-L3"
                     /isolation_source="marine"
                     /db_xref="taxon:6706"
                     /chromosome="Unknown"
                     /sex="male"
                     /tissue_type="heart & testis"
                     /geo_loc_name="USA: Gloucester, Massachusetts"
                     /collection_date="2015"
     gene            1..>1065
                     /gene="LOC121877077"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 100% coverage of the annotated
                     genomic feature by RNAseq alignments, including 25 samples
                     with support for all annotated introns"
                     /db_xref="GeneID:121877077"
     CDS             220..>1065
                     /gene="LOC121877077"
                     /codon_start=1
                     /product="protein argonaute-1-like"
                     /protein_id="XP_042238640.1"
                     /db_xref="GeneID:121877077"
                     /translation="
MEIFEKMKMIYEKDFKNYPLAYDSERNAYSVGVIPALQTPDCQSTYEIDLEESDGKRTQYKISLMVRHRANLQELTEALNCSAREQKTLPLNIFQMVEVMFRHYRAIKYELVGRRNFYSAGGEFGTPYPIGCGKEGVTGFFGSMRPASWKDGSLLLNIDVAHTAFYKEQPLLNFIQDFMNFREDDFHRPLEPFKRSKLLQELRNIRVQVTHSNIPRTYKIIDVSEHSAEKQTFPLKDENTGNTVYCTIENYFKNQYGKKIKFPKLNCVQVSPAERNVFIPFE"
     misc_feature    226..>1065
                     /gene="LOC121877077"
                     /note="protein argonaute; Provisional; Region: PLN03202"
                     /db_xref="CDD:215631"
     misc_feature    721..1065
                     /gene="LOC121877077"
                     /note="PAZ domain, argonaute_like subfamily. Argonaute is
                     part of the RNA-induced silencing complex (RISC), and is
                     an endonuclease that plays a key role in the RNA
                     interference pathway. The PAZ domain has been named after
                     the proteins Piwi,Argonaut, and Zwille; Region:
                     PAZ_argonaute_like; cd02846"
                     /db_xref="CDD:239212"
     misc_feature    order(871..873,916..918,961..963,973..975,1027..1029,
                     1048..1050,1054..1056)
                     /gene="LOC121877077"
                     /note="nucleic acid-binding interface [nucleotide
                     binding]; other site"
                     /db_xref="CDD:239212"
ORIGIN      
ctaatcttcaaaaagcaccgcagcagtcggtagtcaggtcatttgagtaatgatccgaagcctccacctaggacagatgttggctctaaaggcctgaaaattaacctggagacaaactattttccaatcagtgttaaaaataagtttgcagaactggttcattatgaagtctctctaaaaaaacacaacaaagatgcaaatcttccacgaaaaacgaaaatggagatatttgaaaaaatgaagatgatatatgaaaaggatttcaagaattacccacttgcttatgactcagaaaggaatgcatacagtgtgggtgtcatccctgctcttcaaactcctgattgccagagtacttatgagattgaccttgaggaatcagatggcaagaggacacaatacaaaatttcactaatggtgagacatcgtgccaacctccaggaacttacggaggcacttaactgctctgctcgtgaacagaagacacttccattaaacatatttcagatggttgaagtaatgtttcgtcattatcgggccattaagtatgaattggttggtcgtcgtaacttctactcggcaggaggagagtttggaacgccatatccaattggatgtggcaaggaaggtgtgactggtttttttgggtcgatgaggcctgcatcttggaaggatggatctctcttactgaatattgatgttgcacacacagcattctataaagaacaacctcttctgaactttattcaagacttcatgaattttagggaagatgattttcatagaccattagagccatttaaacgatcaaaacttttgcaagaactaagaaatattagggtgcaagttacacactccaatatccctcgcacttacaagattatagatgtttcagaacattctgctgagaaacaaacatttcctttaaaagatgagaatactgggaacacagtttactgcaccattgaaaactacttcaagaaccaatatggaaaaaaaattaagtttccaaagttgaactgtgtacaagtgtctcctgctgaaaggaatgtgtttattccatttgag
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]