GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2026-06-17 14:30:48, GGRNA.v2 : RefSeq release 233 (Jan, 2026)

LOCUS       NR_178188               2181 bp    RNA     linear   ROD 08-APR-2025
DEFINITION  Mus musculus double C2, alpha (Doc2a), transcript variant 8,
            non-coding RNA.
ACCESSION   NR_178188
VERSION     NR_178188.1
KEYWORDS    RefSeq.
SOURCE      Mus musculus (house mouse)
  ORGANISM  Mus musculus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Mus; Mus.
REFERENCE   1  (bases 1 to 2181)
  AUTHORS   Guiberson,N.G.L., Black,L.S., Haller,J.E., Brukner,A., Abramov,D.,
            Ahmad,S., Xie,Y.X., Sharma,M. and Burre,J.
  TITLE     Disease-linked mutations in Munc18-1 deplete synaptic Doc2
  JOURNAL   Brain 147 (6), 2185-2202 (2024)
   PUBMED   38242640
  REMARK    GeneRIF: Disease-linked mutations in Munc18-1 deplete synaptic
            Doc2.
REFERENCE   2  (bases 1 to 2181)
  AUTHORS   Wu,Z., Kusick,G.F., Berns,M.M.M., Raychaudhuri,S., Itoh,K.,
            Walter,A.M., Chapman,E.R. and Watanabe,S.
  TITLE     Synaptotagmin 7 docks synaptic vesicles to support facilitation and
            Doc2alpha-triggered asynchronous release
  JOURNAL   Elife 12, 90632 (2024)
   PUBMED   38536730
  REMARK    GeneRIF: Synaptotagmin 7 docks synaptic vesicles to support
            facilitation and Doc2alpha-triggered asynchronous release.
            Publication Status: Online-Only
REFERENCE   3  (bases 1 to 2181)
  AUTHORS   Kretz,P.F., Wagner,C., Mikhaleva,A., Montillot,C., Hugel,S.,
            Morella,I., Kannan,M., Fischer,M.C., Milhau,M., Yalcin,I.,
            Brambilla,R., Selloum,M., Herault,Y., Reymond,A., Collins,S.C. and
            Yalcin,B.
  TITLE     Dissecting the autism-associated 16p11.2 locus identifies multiple
            drivers in neuroanatomical phenotypes and unveils a male-specific
            role for the major vault protein
  JOURNAL   Genome Biol 24 (1), 261 (2023)
   PUBMED   37968726
  REMARK    Publication Status: Online-Only
REFERENCE   4  (bases 1 to 2181)
  AUTHORS   Wang,Q.W., Qin,J., Chen,Y.F., Tu,Y., Xing,Y.Y., Wang,Y., Yang,L.Y.,
            Lu,S.Y., Geng,L., Shi,W., Yang,Y. and Yao,J.
  TITLE     16p11.2 CNV gene Doc2alpha functions in neurodevelopment and social
            behaviors through interaction with Secretagogin
  JOURNAL   Cell Rep 42 (7), 112691 (2023)
   PUBMED   37354460
  REMARK    GeneRIF: 16p11.2 CNV gene Doc2alpha functions in neurodevelopment
            and social behaviors through interaction with Secretagogin.
REFERENCE   5  (bases 1 to 2181)
  AUTHORS   Bourgeois-Jaarsma,Q., Miaja Hernandez,P. and Groffen,A.J.
  TITLE     Ca2+ sensor proteins in spontaneous release and synaptic
            plasticity: Limited contribution of Doc2c, rabphilin-3a and
            synaptotagmin 7 in hippocampal glutamatergic neurons
  JOURNAL   Mol Cell Neurosci 112, 103613 (2021)
   PUBMED   33753311
  REMARK    GeneRIF: Ca(2+) sensor proteins in spontaneous release and synaptic
            plasticity: Limited contribution of Doc2c, rabphilin-3a and
            synaptotagmin 7 in hippocampal glutamatergic neurons.
REFERENCE   6  (bases 1 to 2181)
  AUTHORS   Groffen,A.J., Friedrich,R., Brian,E.C., Ashery,U. and Verhage,M.
  TITLE     DOC2A and DOC2B are sensors for neuronal activity with unique
            calcium-dependent and kinetic properties
  JOURNAL   J Neurochem 97 (3), 818-833 (2006)
   PUBMED   16515538
REFERENCE   7  (bases 1 to 2181)
  AUTHORS   Toonen,R.F., de Vries,K.J., Zalm,R., Sudhof,T.C. and Verhage,M.
  TITLE     Munc18-1 stabilizes syntaxin 1, but is not essential for syntaxin 1
            targeting and SNARE complex formation
  JOURNAL   J Neurochem 93 (6), 1393-1400 (2005)
   PUBMED   15935055
REFERENCE   8  (bases 1 to 2181)
  AUTHORS   Bouwman,J., Maia,A.S., Camoletto,P.G., Posthuma,G., Roubos,E.W.,
            Oorschot,V.M., Klumperman,J. and Verhage,M.
  TITLE     Quantification of synapse formation and maintenance in vivo in the
            absence of synaptic release
  JOURNAL   Neuroscience 126 (1), 115-126 (2004)
   PUBMED   15145078
REFERENCE   9  (bases 1 to 2181)
  AUTHORS   Sakaguchi,G., Manabe,T., Kobayashi,K., Orita,S., Sasaki,T.,
            Naito,A., Maeda,M., Igarashi,H., Katsuura,G., Nishioka,H.,
            Mizoguchi,A., Itohara,S., Takahashi,T. and Takai,Y.
  TITLE     Doc2alpha is an activity-dependent modulator of excitatory synaptic
            transmission
  JOURNAL   Eur J Neurosci 11 (12), 4262-4268 (1999)
   PUBMED   10594652
REFERENCE   10 (bases 1 to 2181)
  AUTHORS   Naito,A., Orita,S., Wanaka,A., Sasaki,T., Sakaguchi,G., Maeda,M.,
            Igarashi,H., Tohyama,M. and Takai,Y.
  TITLE     Molecular cloning of mouse Doc2alpha and distribution of its mRNA
            in adult mouse brain
  JOURNAL   Brain Res Mol Brain Res 44 (2), 198-204 (1997)
   PUBMED   9073161
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AC124505.4.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: SRR7345562.2338334.1 [ECO:0000332]
            RNAseq introns              :: partial sample support SAMN00849384,
                                           SAMN01164131 [ECO:0000350]
            ##Evidence-Data-END##
            COMPLETENESS: full length.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-119               AC124505.4         188682-188800
            120-567             AC124505.4         189183-189630
            568-647             AC124505.4         189988-190067
            648-722             AC124505.4         190250-190324
            723-832             AC124505.4         190430-190539
            833-963             AC124505.4         191702-191832
            964-1023            AC124505.4         191908-191967
            1024-1187           AC124505.4         192051-192214
            1188-1269           AC124505.4         192305-192386
            1270-1366           AC124505.4         192477-192573
            1367-2181           AC124505.4         192659-193473
FEATURES             Location/Qualifiers
     source          1..2181
                     /organism="Mus musculus"
                     /mol_type="transcribed RNA"
                     /strain="C57BL/6"
                     /db_xref="taxon:10090"
                     /chromosome="7"
                     /map="7 69.25 cM"
     gene            1..2181
                     /gene="Doc2a"
                     /note="double C2, alpha"
                     /db_xref="GeneID:13446"
                     /db_xref="MGI:MGI:109446"
     misc_RNA        1..2181
                     /gene="Doc2a"
                     /product="double C2, alpha, transcript variant 8"
                     /db_xref="GeneID:13446"
                     /db_xref="MGI:MGI:109446"
     exon            1..119
                     /gene="Doc2a"
                     /inference="alignment:Splign:2.1.0"
     exon            120..567
                     /gene="Doc2a"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    291..1160
                     /gene="Doc2a"
                     /inference="COORDINATES:
                     alignment:Blast2seq::RefSeq|NM_001412324.1"
                     /note="primary ORF has stop codon >50 nucleotides from the
                     terminal splice site; nonsense-mediated decay (NMD)
                     candidate"
     exon            568..647
                     /gene="Doc2a"
                     /inference="alignment:Splign:2.1.0"
     exon            648..722
                     /gene="Doc2a"
                     /inference="alignment:Splign:2.1.0"
     exon            723..832
                     /gene="Doc2a"
                     /inference="alignment:Splign:2.1.0"
     exon            833..963
                     /gene="Doc2a"
                     /inference="alignment:Splign:2.1.0"
     exon            964..1023
                     /gene="Doc2a"
                     /inference="alignment:Splign:2.1.0"
     exon            1024..1187
                     /gene="Doc2a"
                     /inference="alignment:Splign:2.1.0"
     exon            1188..1269
                     /gene="Doc2a"
                     /inference="alignment:Splign:2.1.0"
     exon            1270..1366
                     /gene="Doc2a"
                     /inference="alignment:Splign:2.1.0"
     exon            1367..2181
                     /gene="Doc2a"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      
actcccgccccgcgccgcttctcgctcggtcctcgcccgccgcgccgcagtcgccgccgccgcccagcctgcgcccacgggccgcccgtgccgggcacctgttggaggctcagggacaggactgatctggcaacccacccagccctttgtgaagccaggcctcctgcctgcccaccagccagcgcagatcatcttttccctcgacacccaggaagggagggcagtgaggttcctacagaccccagccggccactccagctctacacccgtctcccagtcagaggtgctgcatgaggggccgcaggggcgatcgcatgaccatcaacatccaggagcacatggccatcaacgtgtgccctggacccatcaggcccatccgccagatctccgactacttccctcgcagggggccaggaccagagggtggcggcggcggcggtggcacgggctgcggggaagccccagctcatctggcccctctggctctggccccccctgcggctctccttggggccactacacccgacgatggagctgaggtagacagctacgactcggatgataccaccgccctgggcacactggaatttgaccttctctatgatcaggcttcctgcatgctgcactgtagaatcctcagggccaagggcctcaagcccatggatttcaatggcctggctgacccctatgtaaagcttcacctcctgccaggagcctgcaaggccaataagctaaaaaccaagacacagaggaacacactgaaccctgtgtggaatgaggagctgacgtacagcgggatcacggatgatgacatcacccacaaggtgctcaggatctctgtctgtgatgaggacaagctgagccacaatgaattcattggggagatccgagtgcccctccgccgcctcaagccttcacagaagaagcattttaacatctgccttgagcgccaggtcccggtcccttccttcaccctcttcaatgtctgcggcgctgaggggcatatcctgttacctgaaggagctggagcaggcagagcagggacctgggctgctggaagagcgcgggcgcatcctgctgagcctcagctacagctctcggcggcatgggctgctggtgggcattgttcgctgtgcgcacctggctgcaatggatgttaacggctactctgacccttatgtgaagacgtacttgagaccagatgtggataagaaatccaagcacaaaacatgtgtaaagaagaagacactaaatccggaatttaatgaggaattcttctatgagattgaactctccactctggccactaagaccctggaggtcacagtctgggactacgacattggcaaatccaatgacttcataggtggtgtgtctctggggccaggagcccggggagaggcccagaaacactggaatgactgtctacatcagccggacacagccctggagcgctggcatactctgaccagcgagctgccccctgcagcaggggcttaccctttggcttgagtgaacagcagctgtccatcacaggccctctggggccgggtccagtacccaaccttcgcacgagtgtgttgcacgtttacatggggtgggatgcccctgccccacactacctgtcttatttttgtgagtctctgtgacgggcctgtcttcttgtgagggactgtggagagctatattcacatatgcaaacttcctcctgcctgccttgctgttacctgcaaatatgcaaccacccgtgcacagggccacgtgggagtctcctgccagtgccccaccccatcctgcagctcctttcttggcctttccaggctgcctggtcccctgccccacagggagggggtcggattagggaagattagaggaggacgtttccaaatagaggaaaggacaaggaaagaaagagccaactctttaatacagagccttcactaaatcccagccctgcgtagctgctcttctaaaggggcggccaccgtaggtctctacctcccgaagatgtagcagacccttttggccactcgtttaaataactgttccctggatggggctgggatgtaagggcaggaccctgccaccttcctcggggacattgtgcatgtttacgccttttctgattgtgtcagtggccgaagcatggcaactgggcatcaataaacatctcttgaggaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]