ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2026-06-17 14:30:38, GGRNA.v2 : RefSeq release 233 (Jan, 2026)
LOCUS NM_022937 1447 bp mRNA linear ROD 05-MAY-2025
DEFINITION Rattus norvegicus double C2 domain alpha (Doc2a), mRNA.
ACCESSION NM_022937
VERSION NM_022937.3
KEYWORDS RefSeq; RefSeq Select.
SOURCE Rattus norvegicus (Norway rat)
ORGANISM Rattus norvegicus
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
Muroidea; Muridae; Murinae; Rattus.
REFERENCE 1 (bases 1 to 1447)
AUTHORS Yao,J., Gaffaney,J.D., Kwon,S.E. and Chapman,E.R.
TITLE Doc2 is a Ca2+ sensor required for asynchronous neurotransmitter
release
JOURNAL Cell 147 (3), 666-677 (2011)
PUBMED 22036572
REFERENCE 2 (bases 1 to 1447)
AUTHORS Pang,Z.P., Bacaj,T., Yang,X., Zhou,P., Xu,W. and Sudhof,T.C.
TITLE Doc2 supports spontaneous synaptic transmission by a
Ca(2+)-independent mechanism
JOURNAL Neuron 70 (2), 244-251 (2011)
PUBMED 21521611
REFERENCE 3 (bases 1 to 1447)
AUTHORS Higashio,H., Nishimura,N., Ishizaki,H., Miyoshi,J., Orita,S.,
Sakane,A. and Sasaki,T.
TITLE Doc2 alpha and Munc13-4 regulate Ca(2+) -dependent secretory
lysosome exocytosis in mast cells
JOURNAL J Immunol 180 (7), 4774-4784 (2008)
PUBMED 18354201
REFERENCE 4 (bases 1 to 1447)
AUTHORS Korteweg,N., Denekamp,F.A., Verhage,M. and Burbach,J.P.
TITLE Different spatiotemporal expression of DOC2 genes in the developing
rat brain argues for an additional, nonsynaptic role of DOC2B in
early development
JOURNAL Eur J Neurosci 12 (1), 165-171 (2000)
PUBMED 10651871
REFERENCE 5 (bases 1 to 1447)
AUTHORS Nagano,F., Orita,S., Sasaki,T., Naito,A., Sakaguchi,G., Maeda,M.,
Watanabe,T., Kominami,E., Uchiyama,Y. and Takai,Y.
TITLE Interaction of Doc2 with tctex-1, a light chain of cytoplasmic
dynein. Implication in dynein-dependent vesicle transport
JOURNAL J Biol Chem 273 (46), 30065-30068 (1998)
PUBMED 9804756
REFERENCE 6 (bases 1 to 1447)
AUTHORS Verhage,M., de Vries,K.J., Roshol,H., Burbach,J.P., Gispen,W.H. and
Sudhof,T.C.
TITLE DOC2 proteins in rat brain: complementary distribution and proposed
function as vesicular adapter proteins in early stages of secretion
JOURNAL Neuron 18 (3), 453-461 (1997)
PUBMED 9115738
REFERENCE 7 (bases 1 to 1447)
AUTHORS Naito,A., Orita,S., Wanaka,A., Sasaki,T., Sakaguchi,G., Maeda,M.,
Igarashi,H., Tohyama,M. and Takai,Y.
TITLE Molecular cloning of mouse Doc2alpha and distribution of its mRNA
in adult mouse brain
JOURNAL Brain Res Mol Brain Res 44 (2), 198-204 (1997)
PUBMED 9073161
COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final
NCBI review. The reference sequence was derived from
JAXUCZ010000001.1.
On Nov 27, 2020 this sequence version replaced NM_022937.2.
##Evidence-Data-START##
Transcript exon combination :: SRR26360194.1008666.1,
SRR26643298.5260.1 [ECO:0000332]
RNAseq introns :: single sample supports all introns
SAMEA5760383, SAMEA5760393
[ECO:0000348]
##Evidence-Data-END##
##RefSeq-Attributes-START##
RefSeq Select criteria :: based on conservation, expression,
longest protein
##RefSeq-Attributes-END##
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-330 JAXUCZ010000001.1 190888919-190889248
331-410 JAXUCZ010000001.1 190889604-190889683
411-485 JAXUCZ010000001.1 190889861-190889935
486-595 JAXUCZ010000001.1 190890046-190890155
596-722 JAXUCZ010000001.1 190891289-190891415
723-782 JAXUCZ010000001.1 190891495-190891554
783-946 JAXUCZ010000001.1 190891637-190891800
947-1028 JAXUCZ010000001.1 190891888-190891969
1029-1125 JAXUCZ010000001.1 190892059-190892155
1126-1447 JAXUCZ010000001.1 190892238-190892559
FEATURES Location/Qualifiers
source 1..1447
/organism="Rattus norvegicus"
/mol_type="mRNA"
/strain="BN"
/db_xref="taxon:10116"
/chromosome="1"
/map="1q36"
gene 1..1447
/gene="Doc2a"
/note="double C2 domain alpha"
/db_xref="GeneID:65031"
/db_xref="RGD:620518"
exon 1..330
/gene="Doc2a"
/inference="alignment:Splign:2.1.0"
CDS 60..1271
/gene="Doc2a"
/note="doc2-alpha; double C2, alpha; double C2-like
domains, alpha"
/codon_start=1
/product="double C2-like domain-containing protein alpha"
/protein_id="NP_075226.1"
/db_xref="GeneID:65031"
/db_xref="RGD:620518"
/translation="
MRGRRGDRMTINIQEHMAINVCPGPIRPIRQISDYFPRRGPGPEGGGGGRGFGEAPAHLAPLALAPPAALLGATTPDDGAEVDSYDSDDTTALGTLEFDLLYDQASCMLHCRILRAKGLKPMDFNGLADPYVKLHLLPGACKANKLKTKTQRNTLNPVWNEELTYSGITDDDITHKVLRISVCDEDKLSHNEFIGEIRVPLRRLKPSQKKHFNICLERQVPLPSPSSMSAALRGISCYLKELEQAEQGPGLLEERGRILLSLSYSSRRHGLLVGIVRCAHLAAMDVNGYSDPYVKTYLRPDVDKKSKHKTCVKKKTLNPEFNEEFFYEMELSTLATKTLEVTVWDYDIGKSNDFIGGVSLGPGARGEAQKHWRDCLHQPDTAVERWHTLTSELPPAAGALPLA"
misc_feature 60..335
/gene="Doc2a"
/note="propagated from UniProtKB/Swiss-Prot (P70611.1);
Region: Interaction with UNC13D and DYNLT1.
/evidence=ECO:0000250"
misc_feature 336..707
/gene="Doc2a"
/note="C2 domain first repeat present in Rabphilin and
Double C2 domain; Region: C2A_Rabphilin_Doc2; cd04035"
/db_xref="CDD:176000"
misc_feature order(426..428,444..446,609..611,615..617,633..635)
/gene="Doc2a"
/note="Ca2+ binding site [ion binding]; other site"
/db_xref="CDD:176000"
misc_feature 711..1268
/gene="Doc2a"
/note="propagated from UniProtKB/Swiss-Prot (P70611.1);
Region: Interaction with UNC13D. /evidence=ECO:0000250"
misc_feature 828..1226
/gene="Doc2a"
/note="C2 domain second repeat present in Rabphilin and
Double C2 domain; Region: C2B_Rabphilin_Doc2; cd08384"
/db_xref="CDD:176030"
misc_feature order(912..914,930..932,1092..1094,1098..1100,1116..1118)
/gene="Doc2a"
/note="Ca2+ binding site [ion binding]; other site"
/db_xref="CDD:176030"
exon 331..410
/gene="Doc2a"
/inference="alignment:Splign:2.1.0"
exon 411..485
/gene="Doc2a"
/inference="alignment:Splign:2.1.0"
exon 486..595
/gene="Doc2a"
/inference="alignment:Splign:2.1.0"
exon 596..722
/gene="Doc2a"
/inference="alignment:Splign:2.1.0"
exon 723..782
/gene="Doc2a"
/inference="alignment:Splign:2.1.0"
exon 783..946
/gene="Doc2a"
/inference="alignment:Splign:2.1.0"
exon 947..1028
/gene="Doc2a"
/inference="alignment:Splign:2.1.0"
exon 1029..1125
/gene="Doc2a"
/inference="alignment:Splign:2.1.0"
exon 1126..1447
/gene="Doc2a"
/inference="alignment:Splign:2.1.0"
ORIGIN
cctacagaccccagccggccactccagctctacacccgtctcccagccagaggtgctgcatgaggggccgcaggggcgatcgcatgaccatcaacatccaggagcacatggccatcaacgtgtgccctggacccatcaggcccatccgccagatctccgactacttccctcgcagggggccaggaccagagggtggcggcggcggcaggggcttcggggaagccccagctcatctggcccctctggctctggccccccctgcggctctccttggggccactacacccgacgatggagctgaggtagacagctacgactcggatgataccactgccctgggcacgctggaatttgaccttctctatgatcaggcttcctgcatgctgcactgtagaatcctcagggccaagggcctcaagcccatggatttcaacggcctggctgacccctatgtaaagctgcacctcctgccaggagcctgcaaggccaataagctaaaaaccaagacacagaggaacacactgaacccagtgtggaacgaggagctgacgtacagtggaatcacagatgacgacatcacccacaaggtgctcaggatctcggtctgtgatgaggacaagctgagtcacaatgaatttattggggagatccgagtgcccctccgccgcctcaagccttcacagaagaagcattttaacatctgccttgagcgtcaggtcccgcttccttcgccctcttcaatgtctgcggcgctgaggggcatatcctgttacctgaaggagctagagcaggcagagcagggacctgggctgttggaagagcgcgggcgcatcctgctgagcctcagctacagctctcggcggcatgggctgctggtgggcattgttcgctgtgctcacctggctgcaatggatgttaacggctactctgacccttatgtgaagacgtacttgagaccagacgtggataagaaatccaagcataagacgtgtgtaaagaagaagacgctgaacccggaatttaatgaggaattcttttatgagatggaactctccactctggctaccaagaccctggaagtcacagtctgggactacgacattggcaaatccaatgacttcataggtggtgtgtctctggggccaggagcccggggagaggcccagaaacactggagagactgtctacatcagccggacacagcagtggagcgctggcataccctgaccagcgagctgcccccagcagcaggggcgttgccgttggcctgaacagactgcagctgcccagcacaggccctctgcggccgggtccagtacccaaccttcgcacgagtgtgttgcacgtttacatgggtgggacgcccctgccccacactacctgtcttatttttgtgagtctctgtgaccgtgggtctatcttcttgtgagggatgtggagagctata
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]