ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2026-06-17 14:31:07, GGRNA.v2 : RefSeq release 233 (Jan, 2026)
LOCUS NM_001159304 1265 bp mRNA linear MAM 10-MAY-2024
DEFINITION Sus scrofa cyclin dependent kinase 1 (CDK1), mRNA.
ACCESSION NM_001159304 XM_001924501
VERSION NM_001159304.2
KEYWORDS RefSeq.
SOURCE Sus scrofa (pig)
ORGANISM Sus scrofa
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Laurasiatheria; Artiodactyla; Suina; Suidae;
Sus.
REFERENCE 1 (bases 1 to 1265)
AUTHORS Mulligan,M.K., Kleiman,J.E., Caldemeyer,A.C., Harding,J.C.S. and
Pasternak,J.A.
TITLE Porcine reproductive and respiratory virus 2 infection of the fetus
results in multi-organ cell cycle suppression
JOURNAL Vet Res 53 (1), 13 (2022)
PUBMED 35189966
REMARK GeneRIF: Expression of CDK1 is down regulated in the heart, spleen,
thymus and skeletal muscle of late gestation fetuses compromised by
viral infection
Publication Status: Online-Only
REFERENCE 2 (bases 1 to 1265)
AUTHORS Fujii,W., Nishimura,T., Kano,K., Sugiura,K. and Naito,K.
TITLE CDK7 and CCNH are components of CDK-activating kinase and are
required for meiotic progression of pig oocytes
JOURNAL Biol Reprod 85 (6), 1124-1132 (2011)
PUBMED 21778139
REMARK GeneRIF: CDK7 and CCNH activate CDC2 by T161 phosphorylation and
make up CDK-activating kinase, which is required for normal meiotic
progression during porcine oocyte maturation.
REFERENCE 3 (bases 1 to 1265)
AUTHORS Zhang,D.X., Cui,X.S. and Kim,N.H.
TITLE Molecular characterization and polyadenylation-regulated expression
of cyclin B1 and Cdc2 in porcine oocytes and early parthenotes
JOURNAL Mol Reprod Dev 77 (1), 38-50 (2010)
PUBMED 19705412
REMARK GeneRIF: Results describe the expression of maternal cyclin B1 and
Cdc2 during in vitro maturation of porcine oocytes.
REFERENCE 4 (bases 1 to 1265)
AUTHORS Nishimura,T., Shimaoka,T., Kano,K. and Naito,K.
TITLE Insufficient amount of Cdc2 and continuous activation of Wee1 B are
the cause of meiotic failure in porcine growing oocytes
JOURNAL J Reprod Dev 55 (5), 553-557 (2009)
PUBMED 19550110
REMARK GeneRIF: insufficient amount of Cdc2 and continuous activation of
Wee1 B are the cause of meiotic failure of small oocytes in pigs
REFERENCE 5 (bases 1 to 1265)
AUTHORS Zhang,D.X., Cui,X.S. and Kim,N.H.
TITLE Involvement of polyadenylation status on maternal gene expression
during in vitro maturation of porcine oocytes
JOURNAL Mol Reprod Dev 76 (9), 881-889 (2009)
PUBMED 19479986
REFERENCE 6 (bases 1 to 1265)
AUTHORS Shimaoka,T., Nishimura,T., Kano,K. and Naito,K.
TITLE Critical effect of pigWee1B on the regulation of meiotic resumption
in porcine immature oocytes
JOURNAL Cell Cycle 8 (15), 2375-2384 (2009)
PUBMED 19633431
REMARK GeneRIF: These results suggest that the inhibitory phosphorylation
of CDC2, which is catalyzed by pigWee1B, but not pigMyt1, is
involved in the meiotic arrest of porcine oocytes.
REFERENCE 7 (bases 1 to 1265)
AUTHORS Holzenspies,J.J., Stoorvogel,W., Colenbrander,B., Roelen,B.A.,
Gutknecht,D.R. and van Haeften,T.
TITLE CDC2/SPDY transiently associates with endoplasmic reticulum exit
sites during oocyte maturation
JOURNAL BMC Dev Biol 9, 8 (2009)
PUBMED 19187565
REMARK GeneRIF: Data demonstrate the presence of a novel structure in the
cortex of porcine oocytes that comprises ERES and transiently
accumulates CDC2 prior to germinal vesicle breakdown.
Publication Status: Online-Only
REFERENCE 8 (bases 1 to 1265)
AUTHORS Chen,W.Y., Yang,J.G. and Li,P.S.
TITLE Effect of dexamethasone on the expression of p34(cdc2) and cyclin
B1 in pig oocytes in vitro
JOURNAL Mol Reprod Dev 56 (1), 74-79 (2000)
PUBMED 10737969
COMMENT VALIDATED REFSEQ: This record has undergone validation or
preliminary review. The reference sequence was derived from
BP161545.1, AEMK02000096.1 and GQ184633.1.
On Dec 19, 2009 this sequence version replaced NM_001159304.1.
Sequence Note: This RefSeq record was created from transcript and
genomic sequence data to make the sequence consistent with the
reference genome assembly. The genomic coordinates used for the
transcript record were based on transcript alignments.
##Evidence-Data-START##
Transcript exon combination :: SRR5250921.8623.1, GFLN01059317.1
[ECO:0000332]
RNAseq introns :: single sample supports all introns
SAMEA103886111, SAMEA103886112
[ECO:0000348]
##Evidence-Data-END##
COMPLETENESS: complete on the 3' end.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-59 BP161545.1 1-59
60-74 AEMK02000096.1 58258009-58258023
75-1264 GQ184633.1 24-1213
1265-1279 AEMK02000096.1 58258009-58258023
FEATURES Location/Qualifiers
source 1..1265
/organism="Sus scrofa"
/mol_type="mRNA"
/db_xref="taxon:9823"
/chromosome="14"
/map="14"
gene 1..1265
/gene="CDK1"
/gene_synonym="CDC2"
/note="cyclin dependent kinase 1"
/db_xref="GeneID:100155762"
/db_xref="VGNC:VGNC:103917"
exon 1..94
/gene="CDK1"
/gene_synonym="CDC2"
/inference="alignment:Splign:2.1.0"
exon 95..156
/gene="CDK1"
/gene_synonym="CDC2"
/inference="alignment:Splign:2.1.0"
misc_feature 111..113
/gene="CDK1"
/gene_synonym="CDC2"
/note="upstream in-frame stop codon"
CDS 120..1013
/gene="CDK1"
/gene_synonym="CDC2"
/note="cell division cycle 2, G1 to S and G2 to M"
/codon_start=1
/product="cyclin-dependent kinase 1"
/protein_id="NP_001152776.1"
/db_xref="GeneID:100155762"
/db_xref="VGNC:VGNC:103917"
/translation="
MEDYTKIEKIGEGTYGVVYKGRHKTTGQVVAMKKIRLESEEEGVPSTAIREISLLKELRHPNIVSLQDVLMQDSRLYLIFEFLSMDLKKYLDSIPPGQFMDSSLVKSYLYQILQGIVFCHSRRVLHRDLKPQNLLIDDKGTIKLADFGLARAFGIPIRVYTHEVVTLWYRSPEVLLGSARYSTPVDIWSIGTIFAELATKKPLFHGDSEIDQLFRIFRALGTPNNEVWPEVESLQDYKNTFPKWKPGSLASHVKNLDENGLDLLSKMLVYDPAKRISGKMALNHPYFNDLDNQVKRM"
misc_feature 126..980
/gene="CDK1"
/gene_synonym="CDC2"
/note="Catalytic domain of the Serine/Threonine Kinase,
Cyclin-Dependent protein Kinase 1 from higher eukaryotes;
Region: STKc_CDK1_euk; cd07861"
/db_xref="CDD:270845"
misc_feature order(147..158,171..173,210..212,216..218,267..269,
309..311,357..368,375..377,381..386,501..503,507..509,
513..518,522..524,555..557,564..566,600..602,606..617,
621..623,735..740)
/gene="CDK1"
/gene_synonym="CDC2"
/note="active site"
/db_xref="CDD:270845"
misc_feature order(147..158,171..173,210..212,216..218,309..311,
357..368,375..377,384..386,513..518,522..524,555..557)
/gene="CDK1"
/gene_synonym="CDC2"
/note="ATP binding site [chemical binding]; other site"
/db_xref="CDD:270845"
misc_feature order(228..230,243..251,255..257,264..269,273..278,
285..290,330..332,468..470,477..488,570..578,582..587,
597..602,936..938,948..956)
/gene="CDK1"
/gene_synonym="CDC2"
/note="CDK/cyclin interface [polypeptide binding]; other
site"
/db_xref="CDD:270845"
misc_feature order(267..269,381..383,501..503,507..509,564..566,
600..602,606..617,621..623,735..740)
/gene="CDK1"
/gene_synonym="CDC2"
/note="polypeptide substrate binding site [polypeptide
binding]; other site"
/db_xref="CDD:270845"
misc_feature 552..623
/gene="CDK1"
/gene_synonym="CDC2"
/note="activation loop (A-loop); other site"
/db_xref="CDD:270845"
exon 157..313
/gene="CDK1"
/gene_synonym="CDC2"
/inference="alignment:Splign:2.1.0"
exon 314..437
/gene="CDK1"
/gene_synonym="CDC2"
/inference="alignment:Splign:2.1.0"
exon 438..608
/gene="CDK1"
/gene_synonym="CDC2"
/inference="alignment:Splign:2.1.0"
exon 609..772
/gene="CDK1"
/gene_synonym="CDC2"
/inference="alignment:Splign:2.1.0"
exon 773..914
/gene="CDK1"
/gene_synonym="CDC2"
/inference="alignment:Splign:2.1.0"
exon 915..1265
/gene="CDK1"
/gene_synonym="CDC2"
/inference="alignment:Splign:2.1.0"
ORIGIN
acttagcttttcaaagctggctctgggagcttaaggagagcgacgctgacgtggtagcccctgccgccgctttcgtcgcgggataataagctgggatctaccacatccactgagtaactatggaagactataccaagatagagaaaattggagaaggtacctatggagttgtgtataagggtagacacaaaactacaggtcaagtggtagccatgaagaaaatcaggctagaaagtgaagaggaaggtgttcctagtactgccattcgagaaatatctctattaaaagaacttcgccatccaaatatagtcagtcttcaagatgtgcttatgcaagactccaggttatatctcatctttgaattcctttctatggatctcaagaaatacttggattctatccctcctggtcagttcatggattcttcacttgttaagagttatttgtaccaaatcctgcaagggattgtgttttgtcactctcgaagagttttacacagagacttaaaacctcaaaatctattgattgatgataaaggaacaattaaactggcagattttggtcttgccagagcttttgggatacctattagagtatatacacatgaggtagtaacactctggtatagatctccagaagtattgctggggtcagctcgctactcaactccagttgatatttggagtataggtaccatatttgccgaactagcaactaagaaaccacttttccacggggattcagaaatcgatcaactcttcagaattttcagagctttgggcactcccaataatgaagtgtggccagaagtggagtctttacaggactataagaatacatttcccaagtggaaaccaggaagcctagcatcccacgtcaaaaacttggatgaaaatggcttggatctgctctcgaaaatgttagtctatgatcctgccaagcgaatttctggcaaaatggcactgaatcatccatattttaatgatttggacaatcaagttaagagaatgtagctttcccacacgttgtatcaagaacagatagttgtatttttactgttaactctgcttttgtcttgtgtatttttcttttctatgttgtaaaacttaagcttacttcatcttctgatttcaaagtgtaacttaaaaatgtaaatattgttctatatgaatttaaatataattctgtatatgtttgtagattccactgtaacaacctatttgttactacaataaaactatataaatctattgttgatgtcaaaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]