GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2026-06-10 07:38:14, GGRNA.v2 : RefSeq release 233 (Jan, 2026)

LOCUS       XR_012822819            2257 bp    RNA     linear   INV 23-JUL-2025
DEFINITION  PREDICTED: Dermacentor variabilis visceral mesodermal
            armadillo-repeats (vimar), transcript variant X13, misc_RNA.
ACCESSION   XR_012822819
VERSION     XR_012822819.1
DBLINK      BioProject: PRJNA1294369
KEYWORDS    RefSeq.
SOURCE      Dermacentor variabilis (American dog tick)
  ORGANISM  Dermacentor variabilis
            Eukaryota; Metazoa; Ecdysozoa; Arthropoda; Chelicerata; Arachnida;
            Acari; Parasitiformes; Ixodida; Ixodoidea; Ixodidae;
            Rhipicephalinae; Dermacentor.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_134568) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Full annotation
            Annotation Name             :: GCF_050947875.1-RS_2025_07
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.4
            Annotation Method           :: Gnomon; cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 07/22/2025
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..2257
                     /organism="Dermacentor variabilis"
                     /mol_type="transcribed RNA"
                     /isolate="Ectoservices"
                     /db_xref="taxon:34621"
                     /chromosome="1"
                     /sex="male"
                     /tissue_type="Whole body"
                     /geo_loc_name="USA: Stillwater, Oklahoma"
                     /collection_date="2022-03"
     gene            1..2257
                     /gene="vimar"
                     /note="visceral mesodermal armadillo-repeats; Derived by
                     automated computational analysis using gene prediction
                     method: Gnomon. Supporting evidence includes similarity
                     to: 1 Protein, and 100% coverage of the annotated genomic
                     feature by RNAseq alignments, including 1 sample with
                     support for all annotated introns"
                     /db_xref="GeneID:142557678"
     misc_RNA        1..2257
                     /gene="vimar"
                     /product="visceral mesodermal armadillo-repeats,
                     transcript variant X13"
                     /db_xref="GeneID:142557678"
ORIGIN      
ttttattttgttgggggcgtgctgcgctgctgcagcggtgaagagtcgcgtaaatgatgcggatgtgcccagttatttcccacaacaacgtgcagtaaagcacactcttgatcagctgcgcgcgaaatggaaagcatcacagaaatactcgatggactgaagctctgcgttggcgacgaacaaaaagtggacgatgccgatttatttcttcgcctgaagagtctcctggcactcctcgcagctgatgaacaacattccaagtccgaagcgaaccggcagcaggtgtgtgagcgtctcgtgaagagtgcgtttgtcagttccacaaaagatattctcaagggttcctcagccgtcactgaagaaaccttggctctccttgttcaagtgatagccgaagcggccaaatatgagcctctgaggaaacagttcacagaagcagctgttgtggatcctctcctgggacttatatctcataagaactatgcagtggtgctccaggcttgccgtgctcttggaaacatctgttatgataacgacgatggaagggaccttgtccgggctaagcaaggtgtcgagcagctgttgcaacttctgcagaatgttcttgaagtcgactcagcaccaagagatctgcatactgttgtttcagggtgcctcctaaatttgaccgatatgcaagaaatacaagaggacgcccttcgtttgggtgtgattgatattctgctcaagtacctccaaaagtattcggatgttgaagatgtcgtcatgcactgtgtcttggtgctcaacggcattgctgattcagacgatggtcgtaagcgacttaccgaaaaacacacactgtctcttctgcttagtaatcttgacagagttttctcggaagaagtgactgaagttttgctcgagttgtttggaaatcttgctgaaagtgatgaggtgaaagaggaccttgtggaactgggcttttgcgagaagctcattgaagtgctgaagcgatttcaacctgggtctggcactcctttgtcagaagagaagcagagcgtgataaagactatctgtgaccttacagtcctagtcctaactggagatgctagcatgcggcatgtctaccaaaatggtagtgggcccatctacaaagccaccatggcatggctccagacggacgatgacaaccttcgtgtggctggagccctttcagcaggcaactttgcccgcaaagatgatcactgcattcagatggtcagagatggtgttgccaaacgtctgctggacctcctcacggagcacactggcacagacggagacatcagactgcagcatgccttactggcagcattgcggaaccttgccatcccattggaaaacaagcctctgctagcagaacttggcgctgttgacaagttgctttcaatgctggctgtggagacattccctgtcgtcttcaaacttctgggcacattacgtatgctagttgataagcaagaggttgtggctacaaagttgggcctaaatgagcaactggtgaagcaccttgtgacgtggtgtagcactgaggaccacccaggtgtcaaaggtgaatcagtgcggctattggcctggatagcgaaaaacagtgcatcacctgaagccaaagcagtactatgccgtctgggtgcattgccgcactgggtgtccatgctttcctccgagcatagtctcatgcaggctgaggggctgctggctctcacactttccctcagtccaccgccatctggtactgctctggaagatttgaaaaaggctgatgttcttcctctgctgcgatcattacttgagtcaccagaaatatcacctgaagctctgcagaatgcagttgctttcactactgcactagccagccttggctacttcgacaacataatctggaaacaaacaagaaaaattactttctgaaatcactggcgaggtcgcaaaaaaattcccctacacagaacacatgctatcccgaaacatggaaagttgatagatgccgcacgacctacggtccagtgaatttcccacaatgtttttgtatatttatgaattttctttaggcacatatttgcctgttgtgtgcattgtttttgtatttttcttaagtttttgcatttcctgcaaattgattttctcctctacatgtatggaattgatgccactgtactccacgctatggtgcaaggacccagtcaagccttttcatgctttttgtccgtgctccaaacatctggcagatgttgaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]