ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2026-06-10 14:24:24, GGRNA.v2 : RefSeq release 233 (Jan, 2026)
LOCUS XR_012591672 363 bp RNA linear VRT 25-JUN-2025
DEFINITION PREDICTED: Sebastes fasciatus uncharacterized LOC141757574
(LOC141757574), ncRNA.
ACCESSION XR_012591672
VERSION XR_012591672.1
DBLINK BioProject: PRJNA1276069
KEYWORDS RefSeq.
SOURCE Sebastes fasciatus (Acadian redfish)
ORGANISM Sebastes fasciatus
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Actinopterygii; Neopterygii; Teleostei; Neoteleostei;
Acanthomorphata; Eupercaria; Perciformes; Scorpaenoidei;
Sebastidae; Sebastinae; Sebastes.
COMMENT MODEL REFSEQ: This record is predicted by automated computational
analysis. This record is derived from a genomic sequence
(NC_133796) annotated using gene prediction method: Gnomon.
Also see:
Documentation of NCBI's Annotation Process
##Genome-Annotation-Data-START##
Annotation Provider :: NCBI RefSeq
Annotation Status :: Full annotation
Annotation Name :: GCF_043250625.1-RS_2025_06
Annotation Pipeline :: NCBI eukaryotic genome annotation
pipeline
Annotation Software Version :: 10.4
Annotation Method :: Gnomon; cmsearch; tRNAscan-SE
Features Annotated :: Gene; mRNA; CDS; ncRNA
Annotation Date :: 06/12/2025
##Genome-Annotation-Data-END##
FEATURES Location/Qualifiers
source 1..363
/organism="Sebastes fasciatus"
/mol_type="transcribed RNA"
/isolate="fSebFas1"
/db_xref="taxon:394691"
/chromosome="2"
/sex="male"
/tissue_type="muscle"
/dev_stage="adult"
/geo_loc_name="Canada: Gulf of St. Lawrence"
/lat_lon="48.183022 N 61.151193 W"
/collection_date="2022-08"
/collected_by="Eric Parent"
gene 1..363
/gene="LOC141757574"
/note="uncharacterized LOC141757574; Derived by automated
computational analysis using gene prediction method:
Gnomon. Supporting evidence includes similarity to: 100%
coverage of the annotated genomic feature by RNAseq
alignments, including 94 samples with support for all
annotated introns"
/db_xref="GeneID:141757574"
ncRNA 1..363
/ncRNA_class="lncRNA"
/gene="LOC141757574"
/product="uncharacterized LOC141757574"
/experiment="COORDINATES: polyA evidence [ECO:0006239]"
/db_xref="GeneID:141757574"
ORIGIN
agagacacgattatcttttggcagtttaggtttgtattagatcgcaccaagttaagagtgtatgttggttctgaaagccccttttctttctcacaatctcttcttgcagcttcctgaagagccgcagtgtgtgtgtgtgcgtgcaggcaggcactatcatgatctcctctgtttggttctggatgtagaagttccactgcagccaggtttttaaaaagaaatactgcagaattcagtaatttgcatgcaaatatccctctaaactaggaaagttcaattcatatttgtgaacatgtgctattctttttcacaccaaaatgtacaacatgagtttcaactcctgttacaatgttggaaacctga
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]