ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2026-06-10 07:38:07, GGRNA.v2 : RefSeq release 233 (Jan, 2026)
LOCUS XM_065952331 1524 bp mRNA linear VRT 24-JUN-2024
DEFINITION PREDICTED: Labrus bergylta probable inactive protein kinase
DDB_G0270444 (LOC136178463), mRNA.
ACCESSION XM_065952331
VERSION XM_065952331.1
DBLINK BioProject: PRJNA1126594
KEYWORDS RefSeq; includes ab initio.
SOURCE Labrus bergylta (ballan wrasse)
ORGANISM Labrus bergylta
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Actinopterygii; Neopterygii; Teleostei; Neoteleostei;
Acanthomorphata; Eupercaria; Labriformes; Labridae; Labrus.
COMMENT MODEL REFSEQ: This record is predicted by automated computational
analysis. This record is derived from a genomic sequence
(NW_027077286) annotated using gene prediction method: Gnomon.
Also see:
Documentation of NCBI's Annotation Process
##Genome-Annotation-Data-START##
Annotation Provider :: NCBI RefSeq
Annotation Status :: Full annotation
Annotation Name :: GCF_963930695.1-RS_2024_06
Annotation Pipeline :: NCBI eukaryotic genome annotation
pipeline
Annotation Software Version :: 10.3
Annotation Method :: Best-placed RefSeq; Gnomon;
cmsearch; tRNAscan-SE
Features Annotated :: Gene; mRNA; CDS; ncRNA
Annotation Date :: 06/21/2024
##Genome-Annotation-Data-END##
##RefSeq-Attributes-START##
ab initio :: 100% of CDS bases
##RefSeq-Attributes-END##
FEATURES Location/Qualifiers
source 1..1524
/organism="Labrus bergylta"
/mol_type="mRNA"
/db_xref="taxon:56723"
/chromosome="Unknown"
gene 1..1524
/gene="LOC136178463"
/note="probable inactive protein kinase DDB_G0270444;
Derived by automated computational analysis using gene
prediction method: Gnomon. Supporting evidence includes
similarity to: 3 Proteins"
/db_xref="GeneID:136178463"
CDS 1..1524
/gene="LOC136178463"
/codon_start=1
/product="probable inactive protein kinase DDB_G0270444"
/protein_id="XP_065808403.1"
/db_xref="GeneID:136178463"
/translation="
MRTSCRASCRTSCRTSCRTSCRTSCRTSCRTSLQDELQDELQDELQEEDELQDELQDELQDELQDELQDELQDEDELQDELQDELQDELQDELQDELKDELQDELQDELQDELQDELQDELQDELKDELQDELQDELQDELQDELQDELKDELQDELQDELQDELQDELKDELQDELQDELQDELQDELQDELQDELKDELKDELQDELQDELKDELQDELQDELQDELQDELQDELQDELKDELKDELQDELQDELQDELQDELQDELQDELKDELQDELQDELQDELQDELQDELQDELQDELQDELQDELQDELQDELQDELQDELQDELQDELQDELQDELQDELQDELQDELKDELQDELQDELQDELQDELQDELQDELQDELQDELQDELQDELQDELQDELQDELQDELQDELQDELQDELQDELKDELQDELQDELQDEDELQDELKDELKDELQDELQDELQDELKDELQDELQDELQDELKDELKDELQQKLPCTP"
misc_feature <97..>1503
/gene="LOC136178463"
/note="Chromosome segregation ATPase Smc [Cell cycle
control, cell division, chromosome partitioning]; Region:
Smc; COG1196"
/db_xref="CDD:440809"
ORIGIN
atgaggacgagctgcagggcgagctgcaggacgagctgcaggacgagctgcaggacgagctgcaggacgagctgcaggacgagctgcaggacgagcttgcaggacgagttgcaggacgagctgcaggacgagctgcaggaagaggacgagttgcaggacgagctgcaggacgagctgcaggacgagctgcaggacgagctgcaggacgaactgcaggacgaggacgagttgcaggacgagttgcaggacgagttgcaggacgagttgcaagacgagttgcaggacgagctgaaggacgagctgcaggacgagttgcaggacgagctgcaggacgagttgcaggacgagttgcaggacgagctgcaggacgagctgaaggacgagttgcaggacgagttgcaggacgagttgcaggacgagttgcaggacgagttgcaggacgagctgaaggacgagctgcaggacgagttgcaggacgagctgcaggacgagttgcaggacgagctgaaggacgagctgcaggacgagttgcaggacgagttgcaggacgagttgcaggacgagttgcaggacgagttgcaggacgagctgaaggacgagctgaaggacgagctgcaggacgagttgcaggacgagctgaaggacgagctgcaggacgagttgcaggacgagttgcaggacgagttgcaggacgagttgcaggacgagttgcaggacgagctgaaggacgagctgaaggacgagctgcaggacgagttgcaggacgagctgcaggacgagttgcaggacgagttgcaggacgagctgcaggacgagctgaaggacgagttgcaggacgagttgcaggacgagttgcaggacgagttgcaggacgagttgcaggacgaactgcaggacgaactgcaggacgagttgcaggacgagttgcaggacgagttgcaggacgagctgcaggacgagttgcaggacgagttgcaggacgagctgcaggacgagttgcaggacgagctgcaggacgagctgcaggacgaactgcaggacgagttgcaggacgagttgcaggacgagctgaaggacgagctgcaggacgagctgcaggacgaactgcaggacgagttgcaggacgaactgcaggacgagctgcaggacgagttgcaggacgagttgcaggacgagctgcaggacgagttgcaggacgaactgcaggacgagctgcaggacgagttgcaggacgagttgcaggacgagctgcaggacgagctgcaggacgagttgcaggacgagctgcaggacgagctgaaggacgagttgcaggacgagttgcaggacgagttgcaggatgaggacgagttgcaggacgagctgaaggacgagctgaaggacgagttgcaggacgagttacaggacgaactgcaggacgagctgaaggacgagttgcaggacgagttgcaggacgaactgcaggacgagctgaaggacgagctgaaggacgagttgcaacagaagctcccctgcactccataa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]