LOCUS       XM_042364970            1421 bp    mRNA    linear   INV 16-JUL-2021
DEFINITION  PREDICTED: Homarus americanus protein argonaute-3-like
            (LOC121865476), transcript variant X3, mRNA.
ACCESSION   XM_042364970
VERSION     XM_042364970.1
DBLINK      BioProject: PRJNA744898
KEYWORDS    RefSeq.
SOURCE      Homarus americanus (American lobster)
  ORGANISM  Homarus americanus
            Eukaryota; Metazoa; Ecdysozoa; Arthropoda; Crustacea;
            Multicrustacea; Malacostraca; Eumalacostraca; Eucarida; Decapoda;
            Pleocyemata; Astacidea; Nephropoidea; Nephropidae; Homarus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_024712997.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Homarus americanus Annotation
                                           Release 100
            Annotation Version          :: 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 9.0
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..1421
                     /organism="Homarus americanus"
                     /mol_type="mRNA"
                     /isolate="GMGI-L3"
                     /isolation_source="marine"
                     /db_xref="taxon:6706"
                     /chromosome="Unknown"
                     /sex="male"
                     /tissue_type="heart & testis"
                     /geo_loc_name="USA: Gloucester, Massachusetts"
                     /collection_date="2015"
     gene            1..1421
                     /gene="LOC121865476"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 100% coverage of the annotated
                     genomic feature by RNAseq alignments, including 24 samples
                     with support for all annotated introns"
                     /db_xref="GeneID:121865476"
     CDS             455..1246
                     /gene="LOC121865476"
                     /codon_start=1
                     /product="protein argonaute-2-like isoform X3"
                     /protein_id="XP_042220904.1"
                     /db_xref="GeneID:121865476"
                     /translation="

MNTPRHRGFVILIYLLFGFSPKIDLEESDGKRTQYKISLMVRHRANLQELTEALNCSAREQKTLPLNIFQMVEVMFRHYRAIKYELVGRRNFYSAGGEFGTPYPIGCGKEGVTGFFGSMRPASWKDGSLLLNIDVAHTAFYKEQPLLNFIQDFMNFREDDFHRPLEPFKRSKLLQELRNIRVQVTHSNIPRTYKIIDVSEHSAEKQTFPLKDENTGNTVYCTIENYFKNQYGKKIKFPKLNCVQVSPAERNVFIPFEGPFCFC"

     misc_feature    719..880
                     /gene="LOC121865476"
                     /note="Argonaute linker 1 domain; Region: ArgoL1;
                     pfam08699"
                     /db_xref="CDD:462567"
     misc_feature    881..1240
                     /gene="LOC121865476"
                     /note="PAZ domain, argonaute_like subfamily. Argonaute is
                     part of the RNA-induced silencing complex (RISC), and is
                     an endonuclease that plays a key role in the RNA
                     interference pathway. The PAZ domain has been named after
                     the proteins Piwi,Argonaut, and Zwille; Region:
                     PAZ_argonaute_like; cd02846"
                     /db_xref="CDD:239212"
     misc_feature    order(1031..1033,1076..1078,1121..1123,1133..1135,
                     1187..1189,1208..1210,1214..1216)
                     /gene="LOC121865476"
                     /note="nucleic acid-binding interface [nucleotide
                     binding]; other site"
                     /db_xref="CDD:239212"
ORIGIN      

aagcatctctcccagtgccagggggaagatgagtcttacgatctgtctttggtgctgggggagggagtgagtagcatgggaggggacgtcctttccttcctggaggaagctggtgttctgcacaagctttgagtttcatctattaacgtttaaatgttttttacaaaagttttatgctactgtttattatttatgtttcttaccttgcaatgcttgatattagtcttaagcttttattttaaattcaacgacatattacccacgctgttgctttgcaagggatgaaattaccacaaacaatcaaacaagtgtatccctcatattcaaaatcgctcataattcgtaatgttttgctattaaaattgtttgtgacagttcgacttctatcattcatatacccttgagttttaataatatctaaactctgtaattttccatatatgtccaaaattttatgaacacacccaggcacagaggctttgtcattctaatttatctgttgtttggtttttcaccaaagattgaccttgaggaatcagatggcaagaggacacaatacaaaatttcactaatggtgagacatcgtgccaacctccaggaacttacggaggcacttaactgctctgctcgtgaacagaagacacttccattaaacatatttcagatggttgaagtaatgtttcgtcattatcgggccattaagtatgaattggttggtcgtcgtaacttctactcggcaggaggagagtttggaacgccatatccaattggatgtggcaaggaaggtgtgactggtttttttgggtcgatgaggcctgcatcttggaaggatggatctctcttactgaatattgatgttgcacacacagcattctataaagaacaacctcttctgaactttattcaagacttcatgaattttagggaagatgattttcatagaccattagagccatttaaacgatcaaaacttttgcaagaactaagaaatattagggtgcaagttacacactccaatatccctcgcacttacaagattatagatgtttcagaacattctgccgagaaacaaacatttcctttaaaagatgagaatactgggaacacagtttactgcaccattgaaaactacttcaagaaccaatatggaaaaaaaattaagtttccaaagttgaactgtgtacaagtgtctcctgctgaaaggaatgtgtttattccatttgagggaccattctgtttctgttgatactggtgtagtggattcctcccctacaaacgccgtttgtcgctgagtagccgaccctctttgaattacccagcctgcacctccagcgccgcctgacgtagcgggggtcaactatcaacccacgcctacccccgccttataagacctcaccccgccgtgaccaccctctttctac

//