GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2026-06-10 11:05:51, GGRNA.v2 : RefSeq release 233 (Jan, 2026)

LOCUS       XM_039851027            2400 bp    mRNA    linear   MAM 16-DEC-2025
DEFINITION  PREDICTED: Pteropus medius argonaute RISC catalytic component 3
            (AGO3), transcript variant X8, mRNA.
ACCESSION   XM_039851027
VERSION     XM_039851027.1
DBLINK      BioProject: PRJNA703023
KEYWORDS    RefSeq.
SOURCE      Pteropus medius (Indian flying fox)
  ORGANISM  Pteropus medius
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Laurasiatheria; Chiroptera; Yinpterochiroptera;
            Pteropodoidea; Pteropodidae; Pteropodinae; Pteropus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_024353787.1) annotated using gene prediction method: Gnomon,
            supported by mRNA evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Updated annotation
            Annotation Name             :: GCF_902729225.1-RS_2025_12
            Annotation Pipeline         :: NCBI Eukaryotic Genome Annotation
                                           Pipeline (EGAP)
            Annotation Software Version :: 10.5
            Annotation Method           :: Gnomon; cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 12/12/2025
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..2400
                     /organism="Pteropus medius"
                     /mol_type="mRNA"
                     /isolation_source="ENVO:00010625"
                     /db_xref="taxon:143291"
                     /chromosome="Unknown"
     gene            1..2400
                     /gene="AGO3"
                     /note="argonaute RISC catalytic component 3; Derived by
                     automated computational analysis using gene prediction
                     method: Gnomon. Supporting evidence includes similarity
                     to: 6 mRNAs, 4 Proteins, and 100% coverage of the
                     annotated genomic feature by RNAseq alignments, including
                     21 samples with support for all annotated introns"
                     /db_xref="GeneID:120593272"
     CDS             184..2064
                     /gene="AGO3"
                     /codon_start=1
                     /product="protein argonaute-3 isoform X5"
                     /protein_id="XP_039706961.1"
                     /db_xref="GeneID:120593272"
                     /translation="
MCEVLDIHNIDEQPRPLTDSHRVKFTKEIKGLKVEVTHCGTMRRKYRVCNVTRRPASHQTFPLQLENGQTVERTVAQYFREKYTLQLKYPHLPCLQVGQEQKHTYLPLEVCNIVAGQRCIKKLTDNQTSTMIKATARSAPDRQEEISRLVRSANYETDPFVQEFQFKVRDEMAHVTGRVLPAPMLQYGGRNRTVATPSHGVWDMRGKQFHTGVEIKMWAIACFATQRQCREEILKGFTDQLRKISKDAGMPIQGQPCFCKYAQGADSVEPMFRHLKNTYSGLQLIIVILPGKTPVYAEVKRVGDTLLGMATQCVQVKNVIKTSPQTLSNLCLKINVKLGGINNILVPHQRPSVFQQPVIFLGADVTHPPAGDGKKPSIAAVVGSMDAHPSRYCATVRVQRPRQEIIQDLASMVRELLIQFYKSTRFKPTRIIFYRDGVSEGQFRQVLYYELLAIREACISLEKDYQPGITYIVVQKRHHTRLFCADRTERVGRSGNIPAGTTVDTDITHPYEFDFYLCSHAGIQGTSRPSHYHVLWDDNCFNADELQLLTYQLCHTYVRCTRSVSIPAPAYYAHLVAFRARYHLVDKEHDSAEGSHVSGQSNGRDPQALAKAVQIHQDTLRTMYFA"
     misc_feature    184..525
                     /gene="AGO3"
                     /note="PAZ domain, argonaute_like subfamily. Argonaute is
                     part of the RNA-induced silencing complex (RISC), and is
                     an endonuclease that plays a key role in the RNA
                     interference pathway. The PAZ domain has been named after
                     the proteins Piwi,Argonaut, and Zwille; Region:
                     PAZ_argonaute_like; cd02846"
                     /db_xref="CDD:239212"
     misc_feature    order(319..321,364..366,406..408,418..420,472..474,
                     493..495,499..501)
                     /gene="AGO3"
                     /note="nucleic acid-binding interface [nucleotide
                     binding]; other site"
                     /db_xref="CDD:239212"
     misc_feature    658..1935
                     /gene="AGO3"
                     /note="PIWI domain, Argonaute-like subfamily. Argonaute is
                     the central component of the RNA-induced silencing complex
                     (RISC) and related complexes. The PIWI domain is the
                     C-terminal portion of Argonaute and consists of two
                     subdomains, one of which provides the...; Region:
                     Piwi_ago-like; cd04657"
                     /db_xref="CDD:240015"
     misc_feature    order(1069..1071,1081..1083,1117..1128,1135..1137,
                     1159..1161,1168..1170,1180..1182,1192..1194)
                     /gene="AGO3"
                     /note="5' RNA guide strand anchoring site [active]"
                     /db_xref="CDD:240015"
     misc_feature    order(1273..1275,1279..1281,1489..1491,1903..1905)
                     /gene="AGO3"
                     /note="active site"
                     /db_xref="CDD:240015"
ORIGIN      
gaaaaaactaatctgagatgccagttaggaggctttttcaatcactagttcaggtttcagtccacatgttacttccttgagaagcagtatttggcacccttcaccccccccaaccagccatcccccaagtctgagttagtttctgccactgccttctacaaagcacaacctgtaattcagttcatgtgtgaagttcttgacattcataatattgatgagcaaccaagacctctgactgattctcatcgggtaaaattcaccaaagagataaaaggtctgaaggttgaagtgactcattgtggaacaatgagacggaaataccgtgtttgtaatgtaacaagaaggcctgccagtcatcaaacctttcctttacagttagaaaatggccaaactgtggagagaacagtagcacaatatttcagagaaaagtatactcttcagctgaagtacccacaccttccctgtctgcaagtggggcaggagcagaaacatacgtatctgccactagaagtctgtaatattgtggcagggcaacgatgtatcaagaagctaaccgacaatcagacttccactatgatcaaagcaacagcaagatctgcaccagatagacaagaggaaattagcagattggtaagaagtgcaaattatgaaacagatccatttgttcaggagtttcaatttaaagttcgggatgaaatggcccatgtaaccggacgcgtacttccagcacctatgctccagtatggaggacggaatcgtacagtagcaacaccaagccatggagtatgggacatgcgaggaaaacagttccacacaggagttgaaatcaaaatgtgggctatagcttgttttgccacacagaggcagtgcagagaagaaatattgaagggtttcacggaccagctgcgtaagatttctaaagatgcggggatgcccatccagggccagccttgcttctgcaaatatgcgcagggggcagacagcgtggagcccatgttccggcatctcaagaacacatactctgggctgcagctcattattgtcatcctgccagggaagacgcccgtgtatgcggaggtgaaacgtgtaggagatacacttttgggtatggctacacagtgtgttcaagtcaagaatgtaataaaaacatcccctcaaactctctcaaacctgtgcctaaagataaatgttaaactcggagggatcaataatattcttgtacctcatcaaagaccatctgtgttccagcaaccagtgatctttttgggagcagatgtcactcatccaccagctggtgatgggaagaagccttctattgctgctgttgtaggtagtatggacgcccacccaagcagatactgtgccacagtaagagttcagagaccccgacaggagatcatccaggacttggcctccatggtccgagaacttctcattcaattttataagtcaactcggttcaaacctactcgtatcatcttttatcgggatggtgtttcagagggacagtttcggcaggtgttatattatgaactactagcaattcgagaagcctgcatcagtttggagaaagattatcaacctggaataacttacattgtagttcagaagagacatcacactcgattattttgtgctgacaggacagaaagggttggaaggagtggcaatatcccagctggaacaacagttgatacagacattacacacccatatgagtttgatttttacctctgtagccatgctggaatacagggtaccagccgtccttcacactatcatgttttatgggatgataactgctttaatgcagatgaacttcagctgctaacttaccagctctgccacacttatgtgcgctgtacacgatctgtttctatacctgcaccagcgtattatgctcacctggtggcattcagagccagatatcatctcgtagacaaagaacatgacagtgctgaaggaagtcacgtttcaggacagagcaatgggcgagatccacaagctcttgccaaggctgtacagattcaccaagataccttacgcacaatgtactttgcttaaaaagtccaagattattctctgagaggaagaactgaaagatgaatcgacatacaacgtgtttccagtggagttcgttgagtggggatgcctgcagccatacagaaaccaacactgtggggaccagggtctgatttttatgttgatacaagtaagattgtttacttcatcaaggaacacagcactattatgcaatatgaaaccagccaacagcgcttttgtgcggtctcctgtaggaagtatcgccaatgttttgttttcactttctttgtagtctaacccttttaatgcctttacctcaagttgcttggcagcacaactatctttgcaaaaaaaaaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]