ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2026-06-10 12:23:40, GGRNA.v2 : RefSeq release 233 (Jan, 2026)
LOCUS XM_039851026 2403 bp mRNA linear MAM 16-DEC-2025 DEFINITION PREDICTED: Pteropus medius argonaute RISC catalytic component 3 (AGO3), transcript variant X7, mRNA. ACCESSION XM_039851026 VERSION XM_039851026.1 DBLINK BioProject: PRJNA703023 KEYWORDS RefSeq. SOURCE Pteropus medius (Indian flying fox) ORGANISM Pteropus medius Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Laurasiatheria; Chiroptera; Yinpterochiroptera; Pteropodoidea; Pteropodidae; Pteropodinae; Pteropus. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_024353787.1) annotated using gene prediction method: Gnomon, supported by mRNA evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI RefSeq Annotation Status :: Updated annotation Annotation Name :: GCF_902729225.1-RS_2025_12 Annotation Pipeline :: NCBI Eukaryotic Genome Annotation Pipeline (EGAP) Annotation Software Version :: 10.5 Annotation Method :: Gnomon; cmsearch; tRNAscan-SE Features Annotated :: Gene; mRNA; CDS; ncRNA Annotation Date :: 12/12/2025 ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..2403 /organism="Pteropus medius" /mol_type="mRNA" /isolation_source="ENVO:00010625" /db_xref="taxon:143291" /chromosome="Unknown" gene 1..2403 /gene="AGO3" /note="argonaute RISC catalytic component 3; Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 6 mRNAs, 4 Proteins, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 41 samples with support for all annotated introns" /db_xref="GeneID:120593272" CDS 187..2067 /gene="AGO3" /codon_start=1 /product="protein argonaute-3 isoform X5" /protein_id="XP_039706960.1" /db_xref="GeneID:120593272" /translation="
MCEVLDIHNIDEQPRPLTDSHRVKFTKEIKGLKVEVTHCGTMRRKYRVCNVTRRPASHQTFPLQLENGQTVERTVAQYFREKYTLQLKYPHLPCLQVGQEQKHTYLPLEVCNIVAGQRCIKKLTDNQTSTMIKATARSAPDRQEEISRLVRSANYETDPFVQEFQFKVRDEMAHVTGRVLPAPMLQYGGRNRTVATPSHGVWDMRGKQFHTGVEIKMWAIACFATQRQCREEILKGFTDQLRKISKDAGMPIQGQPCFCKYAQGADSVEPMFRHLKNTYSGLQLIIVILPGKTPVYAEVKRVGDTLLGMATQCVQVKNVIKTSPQTLSNLCLKINVKLGGINNILVPHQRPSVFQQPVIFLGADVTHPPAGDGKKPSIAAVVGSMDAHPSRYCATVRVQRPRQEIIQDLASMVRELLIQFYKSTRFKPTRIIFYRDGVSEGQFRQVLYYELLAIREACISLEKDYQPGITYIVVQKRHHTRLFCADRTERVGRSGNIPAGTTVDTDITHPYEFDFYLCSHAGIQGTSRPSHYHVLWDDNCFNADELQLLTYQLCHTYVRCTRSVSIPAPAYYAHLVAFRARYHLVDKEHDSAEGSHVSGQSNGRDPQALAKAVQIHQDTLRTMYFA"
misc_feature 187..528
/gene="AGO3"
/note="PAZ domain, argonaute_like subfamily. Argonaute is
part of the RNA-induced silencing complex (RISC), and is
an endonuclease that plays a key role in the RNA
interference pathway. The PAZ domain has been named after
the proteins Piwi,Argonaut, and Zwille; Region:
PAZ_argonaute_like; cd02846"
/db_xref="CDD:239212"
misc_feature order(322..324,367..369,409..411,421..423,475..477,
496..498,502..504)
/gene="AGO3"
/note="nucleic acid-binding interface [nucleotide
binding]; other site"
/db_xref="CDD:239212"
misc_feature 661..1938
/gene="AGO3"
/note="PIWI domain, Argonaute-like subfamily. Argonaute is
the central component of the RNA-induced silencing complex
(RISC) and related complexes. The PIWI domain is the
C-terminal portion of Argonaute and consists of two
subdomains, one of which provides the...; Region:
Piwi_ago-like; cd04657"
/db_xref="CDD:240015"
misc_feature order(1072..1074,1084..1086,1120..1131,1138..1140,
1162..1164,1171..1173,1183..1185,1195..1197)
/gene="AGO3"
/note="5' RNA guide strand anchoring site [active]"
/db_xref="CDD:240015"
misc_feature order(1276..1278,1282..1284,1492..1494,1906..1908)
/gene="AGO3"
/note="active site"
/db_xref="CDD:240015"
ORIGIN
atagaggagaaaaaactaatctgagatgccagttaggaggctttttcaatcactagttcaggtttcagtccacatgttacttccttgagaagcagtatttggcacccttcaccccccccaaccagccatcccccaagtctgatttctgccactgccttctacaaagcacaacctgtaattcagttcatgtgtgaagttcttgacattcataatattgatgagcaaccaagacctctgactgattctcatcgggtaaaattcaccaaagagataaaaggtctgaaggttgaagtgactcattgtggaacaatgagacggaaataccgtgtttgtaatgtaacaagaaggcctgccagtcatcaaacctttcctttacagttagaaaatggccaaactgtggagagaacagtagcacaatatttcagagaaaagtatactcttcagctgaagtacccacaccttccctgtctgcaagtggggcaggagcagaaacatacgtatctgccactagaagtctgtaatattgtggcagggcaacgatgtatcaagaagctaaccgacaatcagacttccactatgatcaaagcaacagcaagatctgcaccagatagacaagaggaaattagcagattggtaagaagtgcaaattatgaaacagatccatttgttcaggagtttcaatttaaagttcgggatgaaatggcccatgtaaccggacgcgtacttccagcacctatgctccagtatggaggacggaatcgtacagtagcaacaccaagccatggagtatgggacatgcgaggaaaacagttccacacaggagttgaaatcaaaatgtgggctatagcttgttttgccacacagaggcagtgcagagaagaaatattgaagggtttcacggaccagctgcgtaagatttctaaagatgcggggatgcccatccagggccagccttgcttctgcaaatatgcgcagggggcagacagcgtggagcccatgttccggcatctcaagaacacatactctgggctgcagctcattattgtcatcctgccagggaagacgcccgtgtatgcggaggtgaaacgtgtaggagatacacttttgggtatggctacacagtgtgttcaagtcaagaatgtaataaaaacatcccctcaaactctctcaaacctgtgcctaaagataaatgttaaactcggagggatcaataatattcttgtacctcatcaaagaccatctgtgttccagcaaccagtgatctttttgggagcagatgtcactcatccaccagctggtgatgggaagaagccttctattgctgctgttgtaggtagtatggacgcccacccaagcagatactgtgccacagtaagagttcagagaccccgacaggagatcatccaggacttggcctccatggtccgagaacttctcattcaattttataagtcaactcggttcaaacctactcgtatcatcttttatcgggatggtgtttcagagggacagtttcggcaggtgttatattatgaactactagcaattcgagaagcctgcatcagtttggagaaagattatcaacctggaataacttacattgtagttcagaagagacatcacactcgattattttgtgctgacaggacagaaagggttggaaggagtggcaatatcccagctggaacaacagttgatacagacattacacacccatatgagtttgatttttacctctgtagccatgctggaatacagggtaccagccgtccttcacactatcatgttttatgggatgataactgctttaatgcagatgaacttcagctgctaacttaccagctctgccacacttatgtgcgctgtacacgatctgtttctatacctgcaccagcgtattatgctcacctggtggcattcagagccagatatcatctcgtagacaaagaacatgacagtgctgaaggaagtcacgtttcaggacagagcaatgggcgagatccacaagctcttgccaaggctgtacagattcaccaagataccttacgcacaatgtactttgcttaaaaagtccaagattattctctgagaggaagaactgaaagatgaatcgacatacaacgtgtttccagtggagttcgttgagtggggatgcctgcagccatacagaaaccaacactgtggggaccagggtctgatttttatgttgatacaagtaagattgtttacttcatcaaggaacacagcactattatgcaatatgaaaccagccaacagcgcttttgtgcggtctcctgtaggaagtatcgccaatgttttgttttcactttctttgtagtctaacccttttaatgcctttacctcaagttgcttggcagcacaactatctttgcaaaaaaaaaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]