GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2026-06-17 17:50:06, GGRNA.v2 : RefSeq release 233 (Jan, 2026)

LOCUS       XM_029513747            2592 bp    mRNA    linear   VRT 15-JUL-2025
DEFINITION  PREDICTED: Echeneis naucrates argonaute RISC component 4 (ago4),
            transcript variant X7, mRNA.
ACCESSION   XM_029513747
VERSION     XM_029513747.1
DBLINK      BioProject: PRJNA548465
KEYWORDS    RefSeq.
SOURCE      Echeneis naucrates (live sharksucker)
  ORGANISM  Echeneis naucrates
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Neoteleostei;
            Acanthomorphata; Carangaria; Carangiformes; Echeneidae; Echeneis.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_042521.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Updated annotation
            Annotation Name             :: GCF_900963305.1-RS_2025_07
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.4
            Annotation Method           :: Gnomon; cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 07/15/2025
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..2592
                     /organism="Echeneis naucrates"
                     /mol_type="mRNA"
                     /db_xref="taxon:173247"
                     /chromosome="11"
     gene            1..2592
                     /gene="ago4"
                     /note="argonaute RISC component 4; Derived by automated
                     computational analysis using gene prediction method:
                     Gnomon. Supporting evidence includes similarity to: 9
                     Proteins, and 94% coverage of the annotated genomic
                     feature by RNAseq alignments, including 1 sample with
                     support for all annotated introns"
                     /db_xref="GeneID:115050728"
     CDS             1..2592
                     /gene="ago4"
                     /codon_start=1
                     /product="protein argonaute-4 isoform X7"
                     /protein_id="XP_029369607.1"
                     /db_xref="GeneID:115050728"
                     /translation="
MEALGPGPPAPTSLFQPPRRPGLGTVGKPIRLLANHFQVQIPKIDVYHYDIDIKPEKRPRRVNREVVDTMVRHFKMQIFGDRQPGYDGKRNMYTAHPLPIGRDRVDLEVTLPGEGKDQTFKVSLQWVSVVSLQMLLEALSGHLNEVPEDSVQALDVITRHLPSMRYTPVGRSFFSPPEGYYHPLGGGREVWFGFHQSVRPAMWNMMLNIDVSATAFYRAQPVIEFMCEVLDIQNINEQTKPLTDSQRVKFTKEIRGLKVEVTHCGQMKRKYRVCNVTRRPASHQTFPLQLENGQAMECTVAQYFKQKYNLQLKYPHLPCLQVGQEQKHTYLPLEVCNIVAGQRCIKKLTDNQTSTMIKATARSAPDRQEEISRLVKSNSMVGGPDPYLKEFGIVVHNDMTEVTGRVLPAPMLQYGGRNKTVATPNQGVWDMRGKQFYAGIEIKVWAVACFAPQKQCREDLLKSFTDQLRKISKDAGMPIQGQPCFCKYAQGADSVEPMFKHLKMSYVGLQLIVVILPGKTPVYAEVKRVGDTLLGMATQCVQVKNVVKTSPQTLSNLCLKINAKLGGINNVLVPHQRPSVFQQPVIFLGADVTHPPAGDGKKPSIAAVVGSMDGHPSRYCATVRVQTSRQDMSQEQLFSQEVIQDLTNMVRELLIQFYKSTRFKPTRIIYYRGGVSEGQMKQVAWPELIAIRKACISLEEDYRPGITYIVVQKRHHTRLFCSDKAERVGKSGNVPAGTTVDSTITHPSEFDFYLCSHAGIQGTSRPSHYHVLWDDNCFTADELQLLTYQLCHTYVRCTRSVSIPAPAYYARLVAFRARYHLVDKDHDSAEGSHVSGQSNGRDPQALAKAVQIHYDTQHTMYFA"
     misc_feature    82..471
                     /gene="ago4"
                     /note="N-terminal domain of argonaute; Region: ArgoN;
                     pfam16486"
                     /db_xref="CDD:465134"
     misc_feature    502..654
                     /gene="ago4"
                     /note="Argonaute linker 1 domain; Region: ArgoL1;
                     pfam08699"
                     /db_xref="CDD:462567"
     misc_feature    655..1017
                     /gene="ago4"
                     /note="PAZ domain, argonaute_like subfamily. Argonaute is
                     part of the RNA-induced silencing complex (RISC), and is
                     an endonuclease that plays a key role in the RNA
                     interference pathway. The PAZ domain has been named after
                     the proteins Piwi,Argonaut, and Zwille; Region:
                     PAZ_argonaute_like; cd02846"
                     /db_xref="CDD:239212"
     misc_feature    order(811..813,856..858,898..900,910..912,964..966,
                     985..987,991..993)
                     /gene="ago4"
                     /note="nucleic acid-binding interface [nucleotide
                     binding]; other site"
                     /db_xref="CDD:239212"
     misc_feature    1156..2463
                     /gene="ago4"
                     /note="PIWI domain, Argonaute-like subfamily. Argonaute is
                     the central component of the RNA-induced silencing complex
                     (RISC) and related complexes. The PIWI domain is the
                     C-terminal portion of Argonaute and consists of two
                     subdomains, one of which provides the...; Region:
                     Piwi_ago-like; cd04657"
                     /db_xref="CDD:240015"
     misc_feature    order(1567..1569,1579..1581,1615..1626,1633..1635,
                     1657..1659,1666..1668,1678..1680,1690..1692)
                     /gene="ago4"
                     /note="5' RNA guide strand anchoring site [active]"
                     /db_xref="CDD:240015"
     misc_feature    order(1771..1773,1777..1779,2017..2019,2431..2433)
                     /gene="ago4"
                     /note="active site"
                     /db_xref="CDD:240015"
ORIGIN      
atggaagcgctcggacccggcccgcctgcccctacctctctgtttcagcctccgcggcgtcccggcctcggcacggtggggaaacccatccggctccttgccaaccacttccaggtgcagattcccaagattgatgtttatcattatgatattgacatcaagcctgagaaacggcctcgaagggtcaacagggaggtggtggacaccatggtgcggcacttcaagatgcagatctttggagaccgacagcctggctacgacgggaagaggaacatgtacacagcacatccactgccaatagggagggacagggtggatttggaggtgaccctgcctggtgaggggaaggatcagacattcaaggtgtccttgcagtgggtgtctgtggtcagtcttcaaatgctgctggaagccctgtccggtcacctgaacgaggtccccgaagactctgtccaggccctggatgtcatcacccggcacctaccctccatgaggtacactccagtggggcgttcatttttctccccgccggagggctactatcatcctctgggtggaggcagggaggtctggtttggtttccatcagtctgtccgtcctgccatgtggaacatgatgctcaatatagatgtgtcggccactgctttctaccgtgcccagcctgtgatagaattcatgtgcgaagtgcttgatatccagaacatcaacgaacagaccaaaccactgacggactcgcagcgcgtcaaattcaccaaggaaataagaggattgaaagttgaggtcacacattgtggtcagatgaagagaaaatatcgagtgtgcaatgtcacacgccgacctgccagccaccaaacgttccccttacagcttgagaatggccaagccatggagtgcacagtagcccagtatttcaagcagaagtacaacctgcagctcaagtatcctcatttgccttgtctacaagtggggcaggaacagaaacacacctaccttcccctggaggtctgtaacattgtagcaggccagcgctgtatcaagaaattgacagacaaccagacatccaccatgattaaagctacagctcgctcagcccccgacagacaagaagagatcagccgactggtcaaaagcaacagcatggtcggggggccagacccttacctgaaggagtttggcattgtggtgcacaatgacatgacggaggttactgggcgtgtgctccctgcgcccatgctgcagtatgggggccggaataaaactgtggccacgcccaaccagggcgtgtgggacatgcgcgggaagcagttctatgctggcatcgagatcaaggtctgggctgtggcctgcttcgccccacagaaacagtgtcgggaagacctgctcaagagcttcactgaccagctgcgaaaaatttcaaaggatgctgggatgcccattcaaggccagccatgtttctgtaaatacgcccaaggagctgacagtgtggagccgatgtttaaacacctcaaaatgtcttatgtcgggctgcagctgattgtggtcattctgcccggcaaaacacctgtctatgccgaggtgaagagggtgggcgacactctcctcggcatggccacccagtgtgtccaggtgaagaacgtagtgaagacgtcccctcagactctctccaacctctgcctcaagatcaacgccaaactgggaggcatcaacaacgttcttgtgcctcatcagaggccctctgtgttccagcagccagtcatctttttgggggccgatgtgacgcatcctcctgcaggtgacgggaagaagccatccattgcggcagtggtgggcagcatggatggccaccccagcagatactgcgcaacagtgcgagtccagacatcacgacaagacatgtcccaggagcagctcttcagccaagaggtcatccaagacttgaccaacatggtgcgggaactgctcatccagttctataagtccacacgcttcaagcccactcgtatcatctattaccgcggcggcgtgtcagagggacagatgaagcaggtggcatggccagagctgatagcaatccgcaaggcgtgcatcagtctggaggaggattacaggccgggcattacctacattgtggtccagaagcgtcaccacactcgtctattctgctctgacaaagctgagcgggtggggaagagtggcaatgtcccagccggcaccacagtggacagtaccatcacacacccgtccgagttcgatttctacctgtgcagccatgctggtattcagggaaccagtcgtccctcccactaccacgtcctgtgggatgacaactgcttcacagcagatgaactgcagctcctcacctaccagctgtgccacacctacgtccgctgcactcgctccgtctccatcccagcaccggcctactacgccaggctagtggccttccgagcccgataccacctggtggacaaagaccacgacagcgctgaaggcagccacgtgtcgggacagagtaatggccgggaccctcaggcactggccaaggcagttcagatccactatgatacccagcacaccatgtacttcgcctga
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]