ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2026-06-17 17:51:01, GGRNA.v2 : RefSeq release 233 (Jan, 2026)
LOCUS XM_021257375 1733 bp mRNA linear ROD 23-MAY-2017 DEFINITION PREDICTED: Heterocephalus glaber testis and ovary specific PAZ domain containing 1 (Topaz1), transcript variant X6, mRNA. ACCESSION XM_021257375 VERSION XM_021257375.1 DBLINK BioProject: PRJNA197330 KEYWORDS RefSeq. SOURCE Heterocephalus glaber (naked mole-rat) ORGANISM Heterocephalus glaber Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Hystricomorpha; Bathyergidae; Heterocephalus. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_004624730.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Heterocephalus glaber Annotation Release 102 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 7.4 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..1733 /organism="Heterocephalus glaber" /mol_type="mRNA" /isolate="NMR 29" /db_xref="taxon:10181" /chromosome="Unknown" /sex="female" gene 1..1733 /gene="Topaz1" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 100% coverage of the annotated genomic feature by RNAseq alignments, including 3 samples with support for all annotated introns" /db_xref="GeneID:110348889" CDS 520..1677 /gene="Topaz1" /codon_start=1 /product="testis- and ovary-specific PAZ domain-containing protein 1 isoform X5" /protein_id="XP_021113034.1" /db_xref="GeneID:110348889" /translation="
MACEKFADFQIFCACIAETLTKDYKEENPAVPFCEFAETVNEDPQNSEVDKTLLGRIGISAIYFYHKLLQWSKGRKVLDKLYELKIHFTSLKGLTGPAKLAPRCQIVNVAAEIFLKSGSLDGAIWVLRESEWIISTPLWPCDRLDVLNRHNLLCTIAHEILPKSLYRQTFEVLQNLPGFQNSQETVEVSQHSLLFNKLLDACIESNSLGMSSSVAEFMVSRKIPIDFSFLRRLITSLGRSCLWLKARTHYKSALSLGCYPPLEGNLYRKLLLVPCYLSEIEMLLAIEIFLVSNASSIQSPGNSTQVLQIVLKRCEENKSRSEDDYQAAVERLILAARISDPKLFIKHVTVNVNKEQVYSLEHCSALKWLKENMKWAGKVWLFSNH"
misc_feature 520..984
/gene="Topaz1"
/note="Putative aspartate racemase; Region:
Asp_Glu_race_2; pfam14669"
/db_xref="CDD:464250"
ORIGIN
ttgagggccttaacatctttgcgtgggttgcctggttttgtctttttcctccctcttttggattcttggtttcttcatctttgaaggtttataatagttgttaggcctttgtcagtggtatacatatattacaattctttccatcttgacccttatttggacattgtgatgggttttgccgtgcaaaaacttctgtttgtatgcaacctaatgtttcaatctttttttttcaattgccctcagttttgagtcatttttttttattgcctctggattttaagttgtaattttccctcccccaaggttttagaggaaattattcacggttccttcaactactcccatgatgttattgttggagttagattcctcatctttttggagtttcttcttaggttacaggtggggcagttcacaaagaactggaagcatgatttagattcagccttgaatgaagtagagaattgtaaagaaaaaggtgactggaccaaattgggaaatttatacattaatgttaaaatggcctgtgaaaagtttgcagatttccaaatattttgcgcttgtattgctgaaacactcacaaaagactataaagaagaaaacccagctgttcctttctgtgaatttgctgagacagttaacgaagatccacagaatagtgaagtagataaaactttgctgggaagaatcggaatcagtgctatatacttctatcacaagctgttgcagtggtccaagggaaggaaggtcttggataagctgtatgagttaaaaatacattttacaagtttaaaaggactcacagggcctgcaaaattagcaccaagatgtcaaattgtgaacgtcgcagcagaaatttttctaaaaagtggaagcctagatggtgccatttgggtattgagggaatcagaatggataatcagtacgccactttggccttgtgatagactggatgtgcttaatcgacataatttgctctgtacaattgcacatgaaatcttacccaagagcctttacagacagacatttgaagttttacagaacctaccaggttttcaaaattctcaagaaactgtggaggtctcacagcatagcttgctttttaataagctcttagatgcctgcatagaaagcaacagtcttggcatgtcatcctcggtggctgaattcatggtttccaggaagatccctattgatttttcctttctgagaagattaataacttctttaggaaggagttgcttatggctcaaagccagaacccactacaaaagtgctctttctctgggttgctacccaccattggagggaaacttataccgaaaacttctacttgttccttgttatttatctgagattgaaatgcttttagctattgaaatcttcttggtatctaatgctagtagtattcagagtccgggaaattctacacaggtgcttcagatagttctgaaaagatgtgaagaaaacaaatctcggagcgaggatgattatcaagctgcagtcgaaaggttgattttggctgctcgcatatcggacccaaagctgttcattaagcacgtgactgtcaacgttaataaggagcaggtttacagcttggaacactgttctgccctgaagtggctgaaagagaatatgaagtgggccggaaaggtttggcttttcagtaaccattagttaataaaggcttttttttaagttcaaataatcattgttgacagtaaaagacaata
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]