GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2026-09-29 00:39:57, GGRNA.v2 : RefSeq release 233 (Jan, 2026)

LOCUS       XM_010124323            1623 bp    mRNA    linear   VRT 07-NOV-2014
DEFINITION  PREDICTED: Chlamydotis macqueenii testis- and ovary-specific PAZ
            domain-containing protein 1-like (LOC104482764), partial mRNA.
ACCESSION   XM_010124323
VERSION     XM_010124323.1
DBLINK      BioProject: PRJNA266006
KEYWORDS    RefSeq; includes ab initio.
SOURCE      Chlamydotis macqueenii (Macqueen's bustard)
  ORGANISM  Chlamydotis macqueenii
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
            Coelurosauria; Aves; Neognathae; Neoaves; Otidimorphae;
            Otidiformes; Otididae; Chlamydotis.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_010488148.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Version          :: Chlamydotis macqueenii Annotation
                                           Release 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 6.1
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
            
            ##RefSeq-Attributes-START##
            ab initio :: 9% of CDS bases
            ##RefSeq-Attributes-END##
            COMPLETENESS: incomplete on the 5' end.
FEATURES             Location/Qualifiers
     source          1..1623
                     /organism="Chlamydotis macqueenii"
                     /mol_type="mRNA"
                     /isolate="BGI_N324"
                     /db_xref="taxon:187382"
                     /chromosome="Unknown"
                     /sex="male"
     gene            <1..1623
                     /gene="LOC104482764"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 1 Protein"
                     /db_xref="GeneID:104482764"
     CDS             <1..1623
                     /gene="LOC104482764"
                     /codon_start=1
                     /product="testis- and ovary-specific PAZ domain-containing
                     protein 1-like"
                     /protein_id="XP_010122625.1"
                     /db_xref="GeneID:104482764"
                     /translation="
ASHSVQHILEMIELPRKYCRFYFSTLRGCERAKCWFWHVPEQGDEKPAVDVVLKVFEHVASLNIRNAVPTLISTFCKLIDAGMLLEFEHFDYIIKLLHQLHASSQELNTVLNMKSRFQERYFGKNWLFDFNLAVAEIQHCKEKSDWTKLGALYVNARTGCEHFHDLQKLSLCISEILTRDSETDRPGVPFCDFADAVIKNSQHNEAHRIFIGRTGISVMCSYHKALQWIKGRKVLDKLHELQIHFTVLKGLTGAERFASRCQIVNKAAEIFLKTGSLDGATWVLRESEWTINAPLWPCDKMDILNRHNLLCTLVHKCLKKSLYRQAFEVLQNLPGFQNHSDTVDVSQYSCLFNKLINACFESKNLGVSSSAVDFMLSKNIAIDFILLRGLITALGRSSLWSKARTYYKSALSLGCYPPLQGNLYHKVLTIPSYLSEVEMLLAIEIFLVSNASDIQSPMVSSQTLQIILKRCEDQTVQNNSDYQAAVERLVLAARISDPKLFLKHMTMNVNMEEVYSLELTSALKWLQENMKWAGKVWLFH"
     misc_feature    409..936
                     /gene="LOC104482764"
                     /note="Putative aspartate racemase; Region:
                     Asp_Glu_race_2; pfam14669"
                     /db_xref="CDD:464250"
     misc_feature    934..1008
                     /gene="LOC104482764"
                     /note="PPR repeat [structural motif]; Region: PPR repeat"
                     /db_xref="CDD:276811"
     misc_feature    1024..1134
                     /gene="LOC104482764"
                     /note="PPR repeat [structural motif]; Region: PPR repeat"
                     /db_xref="CDD:276811"
     misc_feature    1150..1224
                     /gene="LOC104482764"
                     /note="PPR repeat [structural motif]; Region: PPR repeat"
                     /db_xref="CDD:276811"
ORIGIN      
gcttctcattcagtccagcacatcctcgagatgattgaattgccccgtaaatattgcagattttatttctcaactttacgtgggtgtgaaagagcaaaatgctggttttggcatgttcctgaacaaggggatgaaaagccagctgtagatgttgttctgaaagtctttgagcatgtggcttctttgaatatacgaaatgcggtgcctacattaatcagtaccttttgtaagctaattgatgctggtatgctccttgagtttgaacattttgactatattattaagttgcttcaccaattgcacgcttccagtcaggaactaaatactgttttgaacatgaaatccagatttcaggaaagatattttggaaagaactggctttttgacttcaacttggcagtggctgaaattcagcattgcaaggaaaaaagtgattggacaaagctgggagctttgtatgttaatgcaagaactggatgtgaacattttcatgatcttcagaagttgtctttatgtatttctgaaatactaaccagagattctgagacagacagaccaggagttcctttttgtgattttgctgatgcagtaataaaaaattcacaacataatgaagcacacagaattttcattggaaggactggaataagtgtaatgtgttcttaccacaaagcactgcagtggataaagggaaggaaggttttggataaattgcatgagctacagatacattttacagttttgaaaggacttacaggtgcagagagatttgcatcaagatgtcaaattgttaataaagctgcagaaatttttcttaaaactggaagtctggatggagcgacatgggtattgagagagtcagagtggaccataaatgcaccattgtggccctgtgataagatggacatcctcaatcgacataatctgttatgtacgctggtgcacaagtgcttgaagaagagtttatacaggcaggcatttgaagttctgcagaacttaccaggttttcaaaatcactctgatactgtagatgtttctcagtacagctgcctttttaacaagctgataaatgcctgttttgagagcaagaaccttggcgtctcatcttctgcagtagacttcatgctttcaaaaaacatagctattgattttattttacttagaggattaatcacagctttgggaagaagttctttgtggtctaaagctaggacctattacaaaagtgctttatcattgggttgctacccaccactgcagggaaatttatatcacaaagttttgacgattccgtcttacctgtctgaggttgagatgctgttggccattgaaatatttcttgtttcaaatgccagtgatattcaaagtccaatggtttctagtcaaactcttcaaataatactgaaaagatgtgaagatcagacagttcagaataacagtgactatcaagcggcagtggagagactggtcctggctgctcgcatatctgatccaaagctttttcttaagcatatgacaatgaatgtgaatatggaagaagtttacagcttggagctcacatctgctctaaaatggcttcaggagaatatgaaatgggctgggaaggtctggctgtttcactag
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]