GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2026-06-17 17:51:08, GGRNA.v2 : RefSeq release 233 (Jan, 2026)

LOCUS       XM_009866499            1884 bp    mRNA    linear   VRT 24-OCT-2014
DEFINITION  PREDICTED: Apaloderma vittatum testis- and ovary-specific PAZ
            domain-containing protein 1-like (LOC104271729), partial mRNA.
ACCESSION   XM_009866499
VERSION     XM_009866499.1
DBLINK      BioProject: PRJNA263608
KEYWORDS    RefSeq; includes ab initio.
SOURCE      Apaloderma vittatum (bar-tailed trogon)
  ORGANISM  Apaloderma vittatum
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
            Coelurosauria; Aves; Neognathae; Neoaves; Telluraves;
            Coraciimorphae; Trogoniformes; Trogonidae; Apaloderma.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_009708309.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Version          :: Apaloderma vittatum Annotation
                                           Release 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 6.1
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
            
            ##RefSeq-Attributes-START##
            ab initio :: 33% of CDS bases
            ##RefSeq-Attributes-END##
            COMPLETENESS: incomplete on the 5' end.
FEATURES             Location/Qualifiers
     source          1..1884
                     /organism="Apaloderma vittatum"
                     /mol_type="mRNA"
                     /isolate="BGI_N311"
                     /db_xref="taxon:57397"
                     /chromosome="Unknown"
                     /sex="male"
                     /geo_loc_name="Tanzania"
     gene            <1..1884
                     /gene="LOC104271729"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 1 Protein"
                     /db_xref="GeneID:104271729"
     CDS             <1..1884
                     /gene="LOC104271729"
                     /codon_start=1
                     /product="testis- and ovary-specific PAZ domain-containing
                     protein 1-like"
                     /protein_id="XP_009864801.1"
                     /db_xref="GeneID:104271729"
                     /translation="
IRFADGVPDVKQEKMGEAEKSDCKYEEIVNCELLSGLPLRAPKVNDLSEATVMQPQTNDCRFSGKNSLLPLPNYGDFKPRKMEKNAIASPSVQQILEMIELPRKYCRLYFMTLRGCERAKCWFWHVPEQGDEKPSVDVLLKVFEHVASLNIRDAVPTLISTFRKLTDAGMCLKFEHFDCIIKFLHQLQVSSQEINTVLSIKSRFQEGYFEKNWLFDFILAVAEIQHCKEKSDWTKLGALYVTARSGCEDSDDLQKLSLCIAKILTRDSETDSPGVPFCDFADAVIENSQHNGADRIFIGRIGISAMYSYHKLLQWIKGRKVLDKLHELQIHFTVLKGLIGEERLASRCQIVNKAAEIFLKTGSLDGATWVLRESKWTTNAPLWPCDKTDILCRQNLLRTLVHKYLRNSLYRQAFEVLQNLPGFQHCSDAVDVSQYRCLFNKLISACFESNNLGVSSSAVDFMLSKNIAIDFFLLRGLITALGRSSLWSKARTYYKSALSLGCYPPLKGNFYHKLLMIPSYLSEVEMLLTIERFLVSNAKDIQSPMPTSQTLQIILKRCEDQTVQNNSNYQAAVERLILAARVSDPKLFLKHMTMNVNMEEVYSLELTSALKWLQENMKWAGKVWLFP"
     misc_feature    670..1197
                     /gene="LOC104271729"
                     /note="Putative aspartate racemase; Region:
                     Asp_Glu_race_2; pfam14669"
                     /db_xref="CDD:464250"
ORIGIN      
atcaggtttgcagatggagttcctgatgttaaacaagaaaaaatgggtgaagctgaaaaaagtgactgtaaatatgaagaaattgtgaactgtgaattgctatcaggattgccattgcgtgccccaaaagtaaatgacctcagtgaagctacagtgatgcaaccccagacaaatgattgcaggttttcaggaaaaaattctttactgccattgccaaattatggagatttcaagccgcggaagatggagaaaaatgcgattgcttctccttcagtccagcagatccttgagatgattgaattgccccgtaaatattgcagactttatttcatgactttacgtggatgtgaaagagcaaaatgttggttttggcatgttcctgagcaaggagatgaaaagccatcagtagatgttcttctgaaagtttttgagcacgtggcttctttgaatataagagacgctgtccccaccttaatcagtacctttcgtaagctcactgatgctggtatgtgcctcaagtttgaacatttcgactgtattattaagttccttcatcaactgcaggtttccagtcaggaaataaatactgttttgagcataaaatccagatttcaggaaggatattttgaaaagaactggctttttgatttcatcttggcagttgctgaaatccagcattgcaaagaaaaaagtgactggaccaagctgggagctttgtatgttaccgcgagaagtggatgtgaagattctgatgaccttcagaaattgtctttatgtattgctaaaatactaaccagagattctgagacagatagtccaggagttcctttttgtgattttgctgatgcagtaatagaaaattcacaacataatggagcagacagaattttcattggaaggattgggataagtgcaatgtattcttaccacaaattactgcagtggataaagggaaggaaggttttggataaattgcatgagctacagatacattttacagtcttgaaaggacttataggtgaagagaggttagcatcaagatgtcaaattgttaataaagctgcagaaatctttcttaaaactggaagtttggatggagcaacatgggtattgagagagtcaaagtggaccacaaatgcaccgttgtggccctgtgataaaacggacatcctgtgccgacaaaatctcttgcgcacactagtgcacaaatacctgaggaacagtttatacaggcaggcatttgaagttctgcagaacttgccaggtttccaacattgttctgatgctgtagatgtttctcagtacagatgcctttttaacaagctgataagtgcctgttttgagagcaacaaccttggagtctcatcttctgcagtagacttcatgctttcaaaaaacatagctattgatttttttttacttagaggcttaatcacagctttgggaagaagttctttgtggtctaaggctaggacctattacaaaagtgctttatcgttgggttgctacccaccactgaagggaaatttctatcacaaacttctgatgattccgtcttacctgtctgaggttgagatgctgttgaccattgaaagatttcttgtttcaaatgccaaggatattcaaagtccaatgcctactagtcagactcttcaaataatactcaaaagatgtgaagatcagacagttcagaataacagtaactatcaagcagcagtggagagactgatcctggctgctcgtgtatctgatccaaagctttttcttaagcatatgacaatgaatgttaatatggaggaagtttacagcttggagcttacatctgctctaaaatggcttcaggagaatatgaaatgggctgggaaggtctggctgtttccatag
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]