ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2026-06-10 11:05:10, GGRNA.v2 : RefSeq release 233 (Jan, 2026)
LOCUS NR_178188 2181 bp RNA linear ROD 08-APR-2025
DEFINITION Mus musculus double C2, alpha (Doc2a), transcript variant 8,
non-coding RNA.
ACCESSION NR_178188
VERSION NR_178188.1
KEYWORDS RefSeq.
SOURCE Mus musculus (house mouse)
ORGANISM Mus musculus
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
Muroidea; Muridae; Murinae; Mus; Mus.
REFERENCE 1 (bases 1 to 2181)
AUTHORS Guiberson,N.G.L., Black,L.S., Haller,J.E., Brukner,A., Abramov,D.,
Ahmad,S., Xie,Y.X., Sharma,M. and Burre,J.
TITLE Disease-linked mutations in Munc18-1 deplete synaptic Doc2
JOURNAL Brain 147 (6), 2185-2202 (2024)
PUBMED 38242640
REMARK GeneRIF: Disease-linked mutations in Munc18-1 deplete synaptic
Doc2.
REFERENCE 2 (bases 1 to 2181)
AUTHORS Wu,Z., Kusick,G.F., Berns,M.M.M., Raychaudhuri,S., Itoh,K.,
Walter,A.M., Chapman,E.R. and Watanabe,S.
TITLE Synaptotagmin 7 docks synaptic vesicles to support facilitation and
Doc2alpha-triggered asynchronous release
JOURNAL Elife 12, 90632 (2024)
PUBMED 38536730
REMARK GeneRIF: Synaptotagmin 7 docks synaptic vesicles to support
facilitation and Doc2alpha-triggered asynchronous release.
Publication Status: Online-Only
REFERENCE 3 (bases 1 to 2181)
AUTHORS Kretz,P.F., Wagner,C., Mikhaleva,A., Montillot,C., Hugel,S.,
Morella,I., Kannan,M., Fischer,M.C., Milhau,M., Yalcin,I.,
Brambilla,R., Selloum,M., Herault,Y., Reymond,A., Collins,S.C. and
Yalcin,B.
TITLE Dissecting the autism-associated 16p11.2 locus identifies multiple
drivers in neuroanatomical phenotypes and unveils a male-specific
role for the major vault protein
JOURNAL Genome Biol 24 (1), 261 (2023)
PUBMED 37968726
REMARK Publication Status: Online-Only
REFERENCE 4 (bases 1 to 2181)
AUTHORS Wang,Q.W., Qin,J., Chen,Y.F., Tu,Y., Xing,Y.Y., Wang,Y., Yang,L.Y.,
Lu,S.Y., Geng,L., Shi,W., Yang,Y. and Yao,J.
TITLE 16p11.2 CNV gene Doc2alpha functions in neurodevelopment and social
behaviors through interaction with Secretagogin
JOURNAL Cell Rep 42 (7), 112691 (2023)
PUBMED 37354460
REMARK GeneRIF: 16p11.2 CNV gene Doc2alpha functions in neurodevelopment
and social behaviors through interaction with Secretagogin.
REFERENCE 5 (bases 1 to 2181)
AUTHORS Bourgeois-Jaarsma,Q., Miaja Hernandez,P. and Groffen,A.J.
TITLE Ca2+ sensor proteins in spontaneous release and synaptic
plasticity: Limited contribution of Doc2c, rabphilin-3a and
synaptotagmin 7 in hippocampal glutamatergic neurons
JOURNAL Mol Cell Neurosci 112, 103613 (2021)
PUBMED 33753311
REMARK GeneRIF: Ca(2+) sensor proteins in spontaneous release and synaptic
plasticity: Limited contribution of Doc2c, rabphilin-3a and
synaptotagmin 7 in hippocampal glutamatergic neurons.
REFERENCE 6 (bases 1 to 2181)
AUTHORS Groffen,A.J., Friedrich,R., Brian,E.C., Ashery,U. and Verhage,M.
TITLE DOC2A and DOC2B are sensors for neuronal activity with unique
calcium-dependent and kinetic properties
JOURNAL J Neurochem 97 (3), 818-833 (2006)
PUBMED 16515538
REFERENCE 7 (bases 1 to 2181)
AUTHORS Toonen,R.F., de Vries,K.J., Zalm,R., Sudhof,T.C. and Verhage,M.
TITLE Munc18-1 stabilizes syntaxin 1, but is not essential for syntaxin 1
targeting and SNARE complex formation
JOURNAL J Neurochem 93 (6), 1393-1400 (2005)
PUBMED 15935055
REFERENCE 8 (bases 1 to 2181)
AUTHORS Bouwman,J., Maia,A.S., Camoletto,P.G., Posthuma,G., Roubos,E.W.,
Oorschot,V.M., Klumperman,J. and Verhage,M.
TITLE Quantification of synapse formation and maintenance in vivo in the
absence of synaptic release
JOURNAL Neuroscience 126 (1), 115-126 (2004)
PUBMED 15145078
REFERENCE 9 (bases 1 to 2181)
AUTHORS Sakaguchi,G., Manabe,T., Kobayashi,K., Orita,S., Sasaki,T.,
Naito,A., Maeda,M., Igarashi,H., Katsuura,G., Nishioka,H.,
Mizoguchi,A., Itohara,S., Takahashi,T. and Takai,Y.
TITLE Doc2alpha is an activity-dependent modulator of excitatory synaptic
transmission
JOURNAL Eur J Neurosci 11 (12), 4262-4268 (1999)
PUBMED 10594652
REFERENCE 10 (bases 1 to 2181)
AUTHORS Naito,A., Orita,S., Wanaka,A., Sasaki,T., Sakaguchi,G., Maeda,M.,
Igarashi,H., Tohyama,M. and Takai,Y.
TITLE Molecular cloning of mouse Doc2alpha and distribution of its mRNA
in adult mouse brain
JOURNAL Brain Res Mol Brain Res 44 (2), 198-204 (1997)
PUBMED 9073161
COMMENT VALIDATED REFSEQ: This record has undergone validation or
preliminary review. The reference sequence was derived from
AC124505.4.
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: SRR7345562.2338334.1 [ECO:0000332]
RNAseq introns :: partial sample support SAMN00849384,
SAMN01164131 [ECO:0000350]
##Evidence-Data-END##
COMPLETENESS: full length.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-119 AC124505.4 188682-188800
120-567 AC124505.4 189183-189630
568-647 AC124505.4 189988-190067
648-722 AC124505.4 190250-190324
723-832 AC124505.4 190430-190539
833-963 AC124505.4 191702-191832
964-1023 AC124505.4 191908-191967
1024-1187 AC124505.4 192051-192214
1188-1269 AC124505.4 192305-192386
1270-1366 AC124505.4 192477-192573
1367-2181 AC124505.4 192659-193473
FEATURES Location/Qualifiers
source 1..2181
/organism="Mus musculus"
/mol_type="transcribed RNA"
/strain="C57BL/6"
/db_xref="taxon:10090"
/chromosome="7"
/map="7 69.25 cM"
gene 1..2181
/gene="Doc2a"
/note="double C2, alpha"
/db_xref="GeneID:13446"
/db_xref="MGI:MGI:109446"
misc_RNA 1..2181
/gene="Doc2a"
/product="double C2, alpha, transcript variant 8"
/db_xref="GeneID:13446"
/db_xref="MGI:MGI:109446"
exon 1..119
/gene="Doc2a"
/inference="alignment:Splign:2.1.0"
exon 120..567
/gene="Doc2a"
/inference="alignment:Splign:2.1.0"
misc_feature 291..1160
/gene="Doc2a"
/inference="COORDINATES:
alignment:Blast2seq::RefSeq|NM_001412324.1"
/note="primary ORF has stop codon >50 nucleotides from the
terminal splice site; nonsense-mediated decay (NMD)
candidate"
exon 568..647
/gene="Doc2a"
/inference="alignment:Splign:2.1.0"
exon 648..722
/gene="Doc2a"
/inference="alignment:Splign:2.1.0"
exon 723..832
/gene="Doc2a"
/inference="alignment:Splign:2.1.0"
exon 833..963
/gene="Doc2a"
/inference="alignment:Splign:2.1.0"
exon 964..1023
/gene="Doc2a"
/inference="alignment:Splign:2.1.0"
exon 1024..1187
/gene="Doc2a"
/inference="alignment:Splign:2.1.0"
exon 1188..1269
/gene="Doc2a"
/inference="alignment:Splign:2.1.0"
exon 1270..1366
/gene="Doc2a"
/inference="alignment:Splign:2.1.0"
exon 1367..2181
/gene="Doc2a"
/inference="alignment:Splign:2.1.0"
ORIGIN
actcccgccccgcgccgcttctcgctcggtcctcgcccgccgcgccgcagtcgccgccgccgcccagcctgcgcccacgggccgcccgtgccgggcacctgttggaggctcagggacaggactgatctggcaacccacccagccctttgtgaagccaggcctcctgcctgcccaccagccagcgcagatcatcttttccctcgacacccaggaagggagggcagtgaggttcctacagaccccagccggccactccagctctacacccgtctcccagtcagaggtgctgcatgaggggccgcaggggcgatcgcatgaccatcaacatccaggagcacatggccatcaacgtgtgccctggacccatcaggcccatccgccagatctccgactacttccctcgcagggggccaggaccagagggtggcggcggcggcggtggcacgggctgcggggaagccccagctcatctggcccctctggctctggccccccctgcggctctccttggggccactacacccgacgatggagctgaggtagacagctacgactcggatgataccaccgccctgggcacactggaatttgaccttctctatgatcaggcttcctgcatgctgcactgtagaatcctcagggccaagggcctcaagcccatggatttcaatggcctggctgacccctatgtaaagcttcacctcctgccaggagcctgcaaggccaataagctaaaaaccaagacacagaggaacacactgaaccctgtgtggaatgaggagctgacgtacagcgggatcacggatgatgacatcacccacaaggtgctcaggatctctgtctgtgatgaggacaagctgagccacaatgaattcattggggagatccgagtgcccctccgccgcctcaagccttcacagaagaagcattttaacatctgccttgagcgccaggtcccggtcccttccttcaccctcttcaatgtctgcggcgctgaggggcatatcctgttacctgaaggagctggagcaggcagagcagggacctgggctgctggaagagcgcgggcgcatcctgctgagcctcagctacagctctcggcggcatgggctgctggtgggcattgttcgctgtgcgcacctggctgcaatggatgttaacggctactctgacccttatgtgaagacgtacttgagaccagatgtggataagaaatccaagcacaaaacatgtgtaaagaagaagacactaaatccggaatttaatgaggaattcttctatgagattgaactctccactctggccactaagaccctggaggtcacagtctgggactacgacattggcaaatccaatgacttcataggtggtgtgtctctggggccaggagcccggggagaggcccagaaacactggaatgactgtctacatcagccggacacagccctggagcgctggcatactctgaccagcgagctgccccctgcagcaggggcttaccctttggcttgagtgaacagcagctgtccatcacaggccctctggggccgggtccagtacccaaccttcgcacgagtgtgttgcacgtttacatggggtgggatgcccctgccccacactacctgtcttatttttgtgagtctctgtgacgggcctgtcttcttgtgagggactgtggagagctatattcacatatgcaaacttcctcctgcctgccttgctgttacctgcaaatatgcaaccacccgtgcacagggccacgtgggagtctcctgccagtgccccaccccatcctgcagctcctttcttggcctttccaggctgcctggtcccctgccccacagggagggggtcggattagggaagattagaggaggacgtttccaaatagaggaaaggacaaggaaagaaagagccaactctttaatacagagccttcactaaatcccagccctgcgtagctgctcttctaaaggggcggccaccgtaggtctctacctcccgaagatgtagcagacccttttggccactcgtttaaataactgttccctggatggggctgggatgtaagggcaggaccctgccaccttcctcggggacattgtgcatgtttacgccttttctgattgtgtcagtggccgaagcatggcaactgggcatcaataaacatctcttgaggaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]