GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2026-09-30 01:59:36, GGRNA.v2 : RefSeq release 233 (Jan, 2026)

LOCUS       NR_031761               3599 bp    RNA     linear   ROD 06-AUG-2023
DEFINITION  Mus musculus RecQ mediated genome instability 1 (Rmi1), transcript
            variant 3, non-coding RNA.
ACCESSION   NR_031761
VERSION     NR_031761.1
KEYWORDS    RefSeq.
SOURCE      Mus musculus (house mouse)
  ORGANISM  Mus musculus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Mus; Mus.
REFERENCE   1  (bases 1 to 3599)
  AUTHORS   Guiraldelli MF, Eyster C and Pezza RJ.
  TITLE     Genome instability and embryonic developmental defects in RMI1
            deficient mice
  JOURNAL   DNA Repair (Amst) 12 (10), 835-843 (2013)
   PUBMED   23900276
  REMARK    GeneRIF: results demonstrate the importance of RMI1 in maintaining
            genome integrity and normal embryonic development
REFERENCE   2  (bases 1 to 3599)
  AUTHORS   Xue X, Raynard S, Busygina V, Singh AK and Sung P.
  TITLE     Role of replication protein A in double holliday junction
            dissolution mediated by the BLM-Topo IIIalpha-RMI1-RMI2 protein
            complex
  JOURNAL   J Biol Chem 288 (20), 14221-14227 (2013)
   PUBMED   23543748
REFERENCE   3  (bases 1 to 3599)
  AUTHORS   Suwa A, Yoshino M, Kurama T, Shimokawa T and Aramori I.
  TITLE     Glucose regulates RMI1 expression through the E2F pathways in
            adipose cells
  JOURNAL   Endocrine 40 (1), 56-61 (2011)
   PUBMED   21432623
  REMARK    GeneRIF: Glucose regulates RMI1 expression through the E2F pathways
            in adipose cells.
REFERENCE   4  (bases 1 to 3599)
  AUTHORS   Chen H, You MJ, Jiang Y, Wang W and Li L.
  TITLE     RMI1 attenuates tumor development and is essential for early
            embryonic survival
  JOURNAL   Mol Carcinog 50 (2), 80-88 (2011)
   PUBMED   21229605
  REMARK    GeneRIF: These results demonstrated a dual-role of RMI1 in
            embryonic development and tumor suppression.
REFERENCE   5  (bases 1 to 3599)
  AUTHORS   Suwa A, Yoshino M, Yamazaki C, Naitou M, Fujikawa R, Matsumoto S,
            Kurama T, Shimokawa T and Aramori I.
  TITLE     RMI1 deficiency in mice protects from diet and genetic-induced
            obesity
  JOURNAL   FEBS J 277 (3), 677-686 (2010)
   PUBMED   20050919
  REMARK    GeneRIF: results suggest that the regulation of energy balance by
            RMI1 is attributable to the regulation of food intake and E2F8
            expression in adipose tissue.
REFERENCE   6  (bases 1 to 3599)
  AUTHORS   Araki K, Imaizumi T, Sekimoto T, Yoshinobu K, Yoshimuta J, Akizuki
            M, Miura K, Araki M and Yamamura K.
  TITLE     Exchangeable gene trap using the Cre/mutated lox system
  JOURNAL   Cell Mol Biol (Noisy-le-grand) 45 (5), 737-750 (1999)
   PUBMED   10512203
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AC154437.2 and AK079457.1.
            
            Transcript Variant: This variant (3) has an alternate 5' exon,
            compared to variant 1. This variant is represented as non-coding
            due to the presence of an upstream ORF that is predicted to
            interfere with translation of the longest ORF; translation of the
            upstream ORF renders the transcript a candidate for
            nonsense-mediated mRNA decay (NMD).
            
            Sequence Note: This RefSeq record was created from transcript and
            genomic sequence data to make the sequence consistent with the
            reference genome assembly. The genomic coordinates used for the
            transcript record were based on transcript alignments.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AK079457.1, AK139703.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMN00849374, SAMN00849375
                                           [ECO:0000348]
            ##Evidence-Data-END##
            COMPLETENESS: full length.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-20                AC154437.2         143461-143480
            21-608              AK079457.1         9-596
            609-2759            AC154437.2         149372-151522
            2760-3594           AK079457.1         2748-3582
            3595-3599           AC154437.2         152358-152362
FEATURES             Location/Qualifiers
     source          1..3599
                     /organism="Mus musculus"
                     /mol_type="transcribed RNA"
                     /strain="C57BL/6"
                     /db_xref="taxon:10090"
                     /chromosome="13"
                     /map="13 31.05 cM"
     gene            1..3599
                     /gene="Rmi1"
                     /gene_synonym="4932432N11Rik"
                     /note="RecQ mediated genome instability 1"
                     /db_xref="GeneID:74386"
                     /db_xref="MGI:MGI:1921636"
     misc_RNA        1..3599
                     /gene="Rmi1"
                     /gene_synonym="4932432N11Rik"
                     /product="RecQ mediated genome instability 1, transcript
                     variant 3"
                     /db_xref="GeneID:74386"
                     /db_xref="MGI:MGI:1921636"
     exon            1..270
                     /gene="Rmi1"
                     /gene_synonym="4932432N11Rik"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    59..298
                     /gene="Rmi1"
                     /gene_synonym="4932432N11Rik"
                     /inference="COORDINATES: ab initio prediction:ORF Finder"
                     /note="long (>35aa) upstream ORF has strong Kozak
                     sequence; nonsense-mediated decay (NMD) candidate"
     exon            271..359
                     /gene="Rmi1"
                     /gene_synonym="4932432N11Rik"
                     /inference="alignment:Splign:2.1.0"
     exon            360..3599
                     /gene="Rmi1"
                     /gene_synonym="4932432N11Rik"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    389..2239
                     /gene="Rmi1"
                     /gene_synonym="4932432N11Rik"
                     /inference="COORDINATES:
                     alignment:Blast2seq::RefSeq|NM_001168248.2"
                     /note="primary ORF"
ORIGIN      
gccttccgccggcgactccctttgggctggaaggccgcgggcctgagaaaactcgggcatggggatagcccaagccgccatcccggggcgccaacccgctccggggactcgctaccccgaagccctagcccacccagatacctacaggccgcaatcgagtgggagacgagcacgacggcgacgtccgtgcagcggagaagcagaggataatggcgtctgcagcgctgtcgcctgtagcgccctcctcctttctcgttcgcgcactctgtgggtcatttctctgcagaggaggctctgagtactgtactgaccatctagcttgaaatccctcgttagctcacaggctggcctgctaagtggtagatgtggatcctcttacttaaaagaaatgagtgtagctagtgctgtattaagagttgaaacctggcttttggcaacatggcatgttaaggtacctccaatgtggctggaagcttgtgttaactggatccaagaagaaaataataatgctactttgagtcaggcacaaataaataaacaagtgttggagcaatggcttcttactgacctgagagacttggaacatcctctcttacctgatgacattttagaactgccaaagggagaactgaatgggttttatgctctacagatcaattctttggttgatgtgagtcagcctgcttattcacagatacagaagctgagaggaaagaatacaaccaatgatctcgtctcagctgaaacgcagagtactccaaaaccatgggaagtgaggccttctcggatgctgatgctacagctcactgatggtgtcacacacattcagggaatggagtatcagtctatcccagctctccatagtggtcttcctccaggtacaaaaattttagttcgtggatgcattttgttccgtcttggtgttctcttactgaaaccagaaaatgtgaaggtgctagggggtgaggtagatggtctttcagaagaaaatgcccaagaaaaagtacttgcaagattaattggggaacttgatcctacagttccagtcattccaaataattccattcacaacgtgcccaaagtttcagggggcttagatgctgttttggggccctcggatgaagaactcttggcaagtcttgatgaaagtgaagagtctgcagcaaataatgacgtggctatggaaagaagctgtttcagcacaggcacttcctcaaatactactccgacaaatccgtctggttttgagccaggatgtaacatttcttcaaggccaaaggagaaaccaccaaaccagcccacgcatttcactgatggagaatttgatgacttttcactggaagaggccttgcttttggaagagactgtccagaaagaacagatggaaacaaaagcatcgcagccactaactttgaaggaaaacactggtaaatgtatggagattttttcacataaacctagtagtctgaaccacacagctttgattcataaacaaggaaacagcaattttgatgaaaaaacatctgaacaaatgattcatgaagacaaattttttgattgtgcatctactagaaaccatcataagagattctcagctcatgattttacaaatgacagtaagatttcagaagtagatgatgcagcacaacagaccctcagcagttcaaatgtacattgcttacgtaataaaatattaaacagaaagctggacctatcagaaaagagttcacaaatttctaaagaaaatggccaccctttccaggcttgttcttcaagatcatttgagaataatacttatctatctattggcatggacttacattctccaccctttatctatttgtctgttctaatggccagaaagccaaaggaagttactactgtgacagtcaaagcgtttattgtcactttaactggaaatctctcaagttctggtggcttttggggtgtaactgcaaaagtttctgatggtactgcatatctagatgtagattttatagacgaaatacttaccagtatgatagggtattcagtaccagaaatgaaacaattaagaaaggaccctcttaaatataaaacattcctagaagggttacagaaatgtcagcgagatctgatcgatttgtgttgcctgatgactatttcatacgatccttcttcatgtaaaggggtggtgctggaattgcaagatgttggtatggaacacgtggagaacctaaagaaacggttgaataaataatttgccagaatgctattggagcacactttaaaacaggcaaatatttggaatcaaatttgtgtattctcagttttggaattctgtaagaaaaagcttcagagcttaaagctggggcagctccgcggttgacagacacagtgtctgccaagtgtggtaactggagtttaaccatctggtctctcgaggcaaaaggcgagaccctgcttccagaatccgttggtagtcctctacacaggtggcagaggacacacacacacacacacgtactaaataaatgacatttaaaaataaagatatttaatcaaaatatgtgaaagaatgtttatattttggtgatactggcccagagtcttgtaatgctagcaagtttctaccatagttacatctctagatccttgggatgtttgtttgttttgtttatttttttgttttccctccctggaaactggatctcatacacaggctgtcctcaaactctcttgtatagctgagagtgacctcgagtttctggtctcttgccttcaccacccaagtgctagatttagggttgtacatttttacctgtgcgtgctaggcaaatgctctaccaactgagccatatccccagtccttgttgaagggtttagctgacccactctggctgagaaacttgttttccacttgtcattggataaacctaaaattgataaagaatagtgatggactgacagcagtttgttgggtaaaggtgcttgctgctgagcctgacaacctgatgctattcctggtaccacatgctggaaagcgaaaactctcccacaagatggcctctgatttccacctgcatgccaaaacgtgtgtgctccctcccatacataaaggtacacacaatgaaataaaatttaataaagagttgatgttccccagtgagatattactgaaagttaggaattgaaaattagtaattttacctctaataagttgaatattaaaaaaaattgtactgtgatttagatatcttccatttactgtgtgtataggtcagagggcagcctgggacacttggctttctcctgctgtgtggattcatggggtaaaatcctcaggctctgcacgcaccttgtacctgctgagctgtgaggatggctctggcttttgagatagtatcctgatacgtttccaggatcctgcgaattggctttgcatatgagttatttgtgttattgttttaaagagactagactatttccttttgctgtactagattatgtttgggagatgtacttttaaaattgtaaaagtgtgtgtgtgtgtagagattgatgaatggaatgaacctctgaacctgtaagccatccccaattaaatgtccttagaagag
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]