GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2026-06-10 11:06:02, GGRNA.v2 : RefSeq release 233 (Jan, 2026)

LOCUS       NM_001159304            1265 bp    mRNA    linear   MAM 10-MAY-2024
DEFINITION  Sus scrofa cyclin dependent kinase 1 (CDK1), mRNA.
ACCESSION   NM_001159304 XM_001924501
VERSION     NM_001159304.2
KEYWORDS    RefSeq.
SOURCE      Sus scrofa (pig)
  ORGANISM  Sus scrofa
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Laurasiatheria; Artiodactyla; Suina; Suidae;
            Sus.
REFERENCE   1  (bases 1 to 1265)
  AUTHORS   Mulligan,M.K., Kleiman,J.E., Caldemeyer,A.C., Harding,J.C.S. and
            Pasternak,J.A.
  TITLE     Porcine reproductive and respiratory virus 2 infection of the fetus
            results in multi-organ cell cycle suppression
  JOURNAL   Vet Res 53 (1), 13 (2022)
   PUBMED   35189966
  REMARK    GeneRIF: Expression of CDK1 is down regulated in the heart, spleen,
            thymus and skeletal muscle of late gestation fetuses compromised by
            viral infection
            Publication Status: Online-Only
REFERENCE   2  (bases 1 to 1265)
  AUTHORS   Fujii,W., Nishimura,T., Kano,K., Sugiura,K. and Naito,K.
  TITLE     CDK7 and CCNH are components of CDK-activating kinase and are
            required for meiotic progression of pig oocytes
  JOURNAL   Biol Reprod 85 (6), 1124-1132 (2011)
   PUBMED   21778139
  REMARK    GeneRIF: CDK7 and CCNH activate CDC2 by T161 phosphorylation and
            make up CDK-activating kinase, which is required for normal meiotic
            progression during porcine oocyte maturation.
REFERENCE   3  (bases 1 to 1265)
  AUTHORS   Zhang,D.X., Cui,X.S. and Kim,N.H.
  TITLE     Molecular characterization and polyadenylation-regulated expression
            of cyclin B1 and Cdc2 in porcine oocytes and early parthenotes
  JOURNAL   Mol Reprod Dev 77 (1), 38-50 (2010)
   PUBMED   19705412
  REMARK    GeneRIF: Results describe the expression of maternal cyclin B1 and
            Cdc2 during in vitro maturation of porcine oocytes.
REFERENCE   4  (bases 1 to 1265)
  AUTHORS   Nishimura,T., Shimaoka,T., Kano,K. and Naito,K.
  TITLE     Insufficient amount of Cdc2 and continuous activation of Wee1 B are
            the cause of meiotic failure in porcine growing oocytes
  JOURNAL   J Reprod Dev 55 (5), 553-557 (2009)
   PUBMED   19550110
  REMARK    GeneRIF: insufficient amount of Cdc2 and continuous activation of
            Wee1 B are the cause of meiotic failure of small oocytes in pigs
REFERENCE   5  (bases 1 to 1265)
  AUTHORS   Zhang,D.X., Cui,X.S. and Kim,N.H.
  TITLE     Involvement of polyadenylation status on maternal gene expression
            during in vitro maturation of porcine oocytes
  JOURNAL   Mol Reprod Dev 76 (9), 881-889 (2009)
   PUBMED   19479986
REFERENCE   6  (bases 1 to 1265)
  AUTHORS   Shimaoka,T., Nishimura,T., Kano,K. and Naito,K.
  TITLE     Critical effect of pigWee1B on the regulation of meiotic resumption
            in porcine immature oocytes
  JOURNAL   Cell Cycle 8 (15), 2375-2384 (2009)
   PUBMED   19633431
  REMARK    GeneRIF: These results suggest that the inhibitory phosphorylation
            of CDC2, which is catalyzed by pigWee1B, but not pigMyt1, is
            involved in the meiotic arrest of porcine oocytes.
REFERENCE   7  (bases 1 to 1265)
  AUTHORS   Holzenspies,J.J., Stoorvogel,W., Colenbrander,B., Roelen,B.A.,
            Gutknecht,D.R. and van Haeften,T.
  TITLE     CDC2/SPDY transiently associates with endoplasmic reticulum exit
            sites during oocyte maturation
  JOURNAL   BMC Dev Biol 9, 8 (2009)
   PUBMED   19187565
  REMARK    GeneRIF: Data demonstrate the presence of a novel structure in the
            cortex of porcine oocytes that comprises ERES and transiently
            accumulates CDC2 prior to germinal vesicle breakdown.
            Publication Status: Online-Only
REFERENCE   8  (bases 1 to 1265)
  AUTHORS   Chen,W.Y., Yang,J.G. and Li,P.S.
  TITLE     Effect of dexamethasone on the expression of p34(cdc2) and cyclin
            B1 in pig oocytes in vitro
  JOURNAL   Mol Reprod Dev 56 (1), 74-79 (2000)
   PUBMED   10737969
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            BP161545.1, AEMK02000096.1 and GQ184633.1.
            
            On Dec 19, 2009 this sequence version replaced NM_001159304.1.
            
            Sequence Note: This RefSeq record was created from transcript and
            genomic sequence data to make the sequence consistent with the
            reference genome assembly. The genomic coordinates used for the
            transcript record were based on transcript alignments.
            
            ##Evidence-Data-START##
            Transcript exon combination :: SRR5250921.8623.1, GFLN01059317.1
                                           [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMEA103886111, SAMEA103886112
                                           [ECO:0000348]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-59                BP161545.1         1-59
            60-74               AEMK02000096.1     58258009-58258023
            75-1264             GQ184633.1         24-1213
            1265-1279           AEMK02000096.1     58258009-58258023
FEATURES             Location/Qualifiers
     source          1..1265
                     /organism="Sus scrofa"
                     /mol_type="mRNA"
                     /db_xref="taxon:9823"
                     /chromosome="14"
                     /map="14"
     gene            1..1265
                     /gene="CDK1"
                     /gene_synonym="CDC2"
                     /note="cyclin dependent kinase 1"
                     /db_xref="GeneID:100155762"
                     /db_xref="VGNC:VGNC:103917"
     exon            1..94
                     /gene="CDK1"
                     /gene_synonym="CDC2"
                     /inference="alignment:Splign:2.1.0"
     exon            95..156
                     /gene="CDK1"
                     /gene_synonym="CDC2"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    111..113
                     /gene="CDK1"
                     /gene_synonym="CDC2"
                     /note="upstream in-frame stop codon"
     CDS             120..1013
                     /gene="CDK1"
                     /gene_synonym="CDC2"
                     /note="cell division cycle 2, G1 to S and G2 to M"
                     /codon_start=1
                     /product="cyclin-dependent kinase 1"
                     /protein_id="NP_001152776.1"
                     /db_xref="GeneID:100155762"
                     /db_xref="VGNC:VGNC:103917"
                     /translation="
MEDYTKIEKIGEGTYGVVYKGRHKTTGQVVAMKKIRLESEEEGVPSTAIREISLLKELRHPNIVSLQDVLMQDSRLYLIFEFLSMDLKKYLDSIPPGQFMDSSLVKSYLYQILQGIVFCHSRRVLHRDLKPQNLLIDDKGTIKLADFGLARAFGIPIRVYTHEVVTLWYRSPEVLLGSARYSTPVDIWSIGTIFAELATKKPLFHGDSEIDQLFRIFRALGTPNNEVWPEVESLQDYKNTFPKWKPGSLASHVKNLDENGLDLLSKMLVYDPAKRISGKMALNHPYFNDLDNQVKRM"
     misc_feature    126..980
                     /gene="CDK1"
                     /gene_synonym="CDC2"
                     /note="Catalytic domain of the Serine/Threonine Kinase,
                     Cyclin-Dependent protein Kinase 1 from higher eukaryotes;
                     Region: STKc_CDK1_euk; cd07861"
                     /db_xref="CDD:270845"
     misc_feature    order(147..158,171..173,210..212,216..218,267..269,
                     309..311,357..368,375..377,381..386,501..503,507..509,
                     513..518,522..524,555..557,564..566,600..602,606..617,
                     621..623,735..740)
                     /gene="CDK1"
                     /gene_synonym="CDC2"
                     /note="active site"
                     /db_xref="CDD:270845"
     misc_feature    order(147..158,171..173,210..212,216..218,309..311,
                     357..368,375..377,384..386,513..518,522..524,555..557)
                     /gene="CDK1"
                     /gene_synonym="CDC2"
                     /note="ATP binding site [chemical binding]; other site"
                     /db_xref="CDD:270845"
     misc_feature    order(228..230,243..251,255..257,264..269,273..278,
                     285..290,330..332,468..470,477..488,570..578,582..587,
                     597..602,936..938,948..956)
                     /gene="CDK1"
                     /gene_synonym="CDC2"
                     /note="CDK/cyclin interface [polypeptide binding]; other
                     site"
                     /db_xref="CDD:270845"
     misc_feature    order(267..269,381..383,501..503,507..509,564..566,
                     600..602,606..617,621..623,735..740)
                     /gene="CDK1"
                     /gene_synonym="CDC2"
                     /note="polypeptide substrate binding site [polypeptide
                     binding]; other site"
                     /db_xref="CDD:270845"
     misc_feature    552..623
                     /gene="CDK1"
                     /gene_synonym="CDC2"
                     /note="activation loop (A-loop); other site"
                     /db_xref="CDD:270845"
     exon            157..313
                     /gene="CDK1"
                     /gene_synonym="CDC2"
                     /inference="alignment:Splign:2.1.0"
     exon            314..437
                     /gene="CDK1"
                     /gene_synonym="CDC2"
                     /inference="alignment:Splign:2.1.0"
     exon            438..608
                     /gene="CDK1"
                     /gene_synonym="CDC2"
                     /inference="alignment:Splign:2.1.0"
     exon            609..772
                     /gene="CDK1"
                     /gene_synonym="CDC2"
                     /inference="alignment:Splign:2.1.0"
     exon            773..914
                     /gene="CDK1"
                     /gene_synonym="CDC2"
                     /inference="alignment:Splign:2.1.0"
     exon            915..1265
                     /gene="CDK1"
                     /gene_synonym="CDC2"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      
acttagcttttcaaagctggctctgggagcttaaggagagcgacgctgacgtggtagcccctgccgccgctttcgtcgcgggataataagctgggatctaccacatccactgagtaactatggaagactataccaagatagagaaaattggagaaggtacctatggagttgtgtataagggtagacacaaaactacaggtcaagtggtagccatgaagaaaatcaggctagaaagtgaagaggaaggtgttcctagtactgccattcgagaaatatctctattaaaagaacttcgccatccaaatatagtcagtcttcaagatgtgcttatgcaagactccaggttatatctcatctttgaattcctttctatggatctcaagaaatacttggattctatccctcctggtcagttcatggattcttcacttgttaagagttatttgtaccaaatcctgcaagggattgtgttttgtcactctcgaagagttttacacagagacttaaaacctcaaaatctattgattgatgataaaggaacaattaaactggcagattttggtcttgccagagcttttgggatacctattagagtatatacacatgaggtagtaacactctggtatagatctccagaagtattgctggggtcagctcgctactcaactccagttgatatttggagtataggtaccatatttgccgaactagcaactaagaaaccacttttccacggggattcagaaatcgatcaactcttcagaattttcagagctttgggcactcccaataatgaagtgtggccagaagtggagtctttacaggactataagaatacatttcccaagtggaaaccaggaagcctagcatcccacgtcaaaaacttggatgaaaatggcttggatctgctctcgaaaatgttagtctatgatcctgccaagcgaatttctggcaaaatggcactgaatcatccatattttaatgatttggacaatcaagttaagagaatgtagctttcccacacgttgtatcaagaacagatagttgtatttttactgttaactctgcttttgtcttgtgtatttttcttttctatgttgtaaaacttaagcttacttcatcttctgatttcaaagtgtaacttaaaaatgtaaatattgttctatatgaatttaaatataattctgtatatgtttgtagattccactgtaacaacctatttgttactacaataaaactatataaatctattgttgatgtcaaaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]