GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2026-06-10 11:07:47, GGRNA.v2 : RefSeq release 233 (Jan, 2026)

LOCUS       XR_013601306             305 bp    RNA     linear   VRT 21-JAN-2026
DEFINITION  PREDICTED: Lissotriton helveticus uncharacterized LOC144782902
            (LOC144782902), ncRNA.
ACCESSION   XR_013601306
VERSION     XR_013601306.1
DBLINK      BioProject: PRJNA1395635
KEYWORDS    RefSeq.
SOURCE      Lissotriton helveticus (palmate newt)
  ORGANISM  Lissotriton helveticus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Amphibia; Batrachia; Caudata; Salamandroidea; Salamandridae;
            Pleurodelinae; Lissotriton.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_136070) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Full annotation
            Annotation Name             :: GCF_964261635.1-RS_2025_12
            Annotation Pipeline         :: NCBI Eukaryotic Genome Annotation
                                           Pipeline (EGAP)
            Annotation Software Version :: 10.5
            Annotation Method           :: Gnomon; cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 12/30/2025
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..305
                     /organism="Lissotriton helveticus"
                     /mol_type="transcribed RNA"
                     /db_xref="taxon:256425"
                     /chromosome="9"
     gene            1..305
                     /gene="LOC144782902"
                     /note="uncharacterized LOC144782902; Derived by automated
                     computational analysis using gene prediction method:
                     Gnomon. Supporting evidence includes similarity to: 100%
                     coverage of the annotated genomic feature by RNAseq
                     alignments, including 1 sample with support for all
                     annotated introns"
                     /db_xref="GeneID:144782902"
     ncRNA           1..305
                     /ncRNA_class="lncRNA"
                     /gene="LOC144782902"
                     /product="uncharacterized LOC144782902"
                     /db_xref="GeneID:144782902"
ORIGIN      
ggggataccaatgtcaatatcttctaggattgtaaatctatttatggtgccatctattcaagaagagattgtgttctgggccatccatcaaatgacaattcaatacggaccagaaattgaatcacacctgggtctggttctcagaaccttctatcctatattgaagactgcttctacagtcaaccagaaatattggtttagccttgtcattgagatgttagcaggccagtttgctgcctctgtagatgctcccctagtcacacttttctttgaagcctactcagcttgcaaggtctttcttcttg
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]