GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2026-06-10 11:07:46, GGRNA.v2 : RefSeq release 233 (Jan, 2026)

LOCUS       XM_039851028            2353 bp    mRNA    linear   MAM 16-DEC-2025
DEFINITION  PREDICTED: Pteropus medius argonaute RISC catalytic component 3
            (AGO3), transcript variant X9, mRNA.
ACCESSION   XM_039851028
VERSION     XM_039851028.1
DBLINK      BioProject: PRJNA703023
KEYWORDS    RefSeq.
SOURCE      Pteropus medius (Indian flying fox)
  ORGANISM  Pteropus medius
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Laurasiatheria; Chiroptera; Yinpterochiroptera;
            Pteropodoidea; Pteropodidae; Pteropodinae; Pteropus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_024353787.1) annotated using gene prediction method: Gnomon,
            supported by mRNA evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Updated annotation
            Annotation Name             :: GCF_902729225.1-RS_2025_12
            Annotation Pipeline         :: NCBI Eukaryotic Genome Annotation
                                           Pipeline (EGAP)
            Annotation Software Version :: 10.5
            Annotation Method           :: Gnomon; cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 12/12/2025
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..2353
                     /organism="Pteropus medius"
                     /mol_type="mRNA"
                     /isolation_source="ENVO:00010625"
                     /db_xref="taxon:143291"
                     /chromosome="Unknown"
     gene            1..2353
                     /gene="AGO3"
                     /note="argonaute RISC catalytic component 3; Derived by
                     automated computational analysis using gene prediction
                     method: Gnomon. Supporting evidence includes similarity
                     to: 6 mRNAs, 4 Proteins, and 100% coverage of the
                     annotated genomic feature by RNAseq alignments, including
                     20 samples with support for all annotated introns"
                     /db_xref="GeneID:120593272"
     CDS             137..2017
                     /gene="AGO3"
                     /codon_start=1
                     /product="protein argonaute-3 isoform X5"
                     /protein_id="XP_039706962.1"
                     /db_xref="GeneID:120593272"
                     /translation="
MCEVLDIHNIDEQPRPLTDSHRVKFTKEIKGLKVEVTHCGTMRRKYRVCNVTRRPASHQTFPLQLENGQTVERTVAQYFREKYTLQLKYPHLPCLQVGQEQKHTYLPLEVCNIVAGQRCIKKLTDNQTSTMIKATARSAPDRQEEISRLVRSANYETDPFVQEFQFKVRDEMAHVTGRVLPAPMLQYGGRNRTVATPSHGVWDMRGKQFHTGVEIKMWAIACFATQRQCREEILKGFTDQLRKISKDAGMPIQGQPCFCKYAQGADSVEPMFRHLKNTYSGLQLIIVILPGKTPVYAEVKRVGDTLLGMATQCVQVKNVIKTSPQTLSNLCLKINVKLGGINNILVPHQRPSVFQQPVIFLGADVTHPPAGDGKKPSIAAVVGSMDAHPSRYCATVRVQRPRQEIIQDLASMVRELLIQFYKSTRFKPTRIIFYRDGVSEGQFRQVLYYELLAIREACISLEKDYQPGITYIVVQKRHHTRLFCADRTERVGRSGNIPAGTTVDTDITHPYEFDFYLCSHAGIQGTSRPSHYHVLWDDNCFNADELQLLTYQLCHTYVRCTRSVSIPAPAYYAHLVAFRARYHLVDKEHDSAEGSHVSGQSNGRDPQALAKAVQIHQDTLRTMYFA"
     misc_feature    137..478
                     /gene="AGO3"
                     /note="PAZ domain, argonaute_like subfamily. Argonaute is
                     part of the RNA-induced silencing complex (RISC), and is
                     an endonuclease that plays a key role in the RNA
                     interference pathway. The PAZ domain has been named after
                     the proteins Piwi,Argonaut, and Zwille; Region:
                     PAZ_argonaute_like; cd02846"
                     /db_xref="CDD:239212"
     misc_feature    order(272..274,317..319,359..361,371..373,425..427,
                     446..448,452..454)
                     /gene="AGO3"
                     /note="nucleic acid-binding interface [nucleotide
                     binding]; other site"
                     /db_xref="CDD:239212"
     misc_feature    611..1888
                     /gene="AGO3"
                     /note="PIWI domain, Argonaute-like subfamily. Argonaute is
                     the central component of the RNA-induced silencing complex
                     (RISC) and related complexes. The PIWI domain is the
                     C-terminal portion of Argonaute and consists of two
                     subdomains, one of which provides the...; Region:
                     Piwi_ago-like; cd04657"
                     /db_xref="CDD:240015"
     misc_feature    order(1022..1024,1034..1036,1070..1081,1088..1090,
                     1112..1114,1121..1123,1133..1135,1145..1147)
                     /gene="AGO3"
                     /note="5' RNA guide strand anchoring site [active]"
                     /db_xref="CDD:240015"
     misc_feature    order(1226..1228,1232..1234,1442..1444,1856..1858)
                     /gene="AGO3"
                     /note="active site"
                     /db_xref="CDD:240015"
ORIGIN      
aagagacttctggcagcagtgtggagaatagatagaggagaaaaaactaatctgagatgccagttaggaggctttttcaatcactagttcagtttctgccactgccttctacaaagcacaacctgtaattcagttcatgtgtgaagttcttgacattcataatattgatgagcaaccaagacctctgactgattctcatcgggtaaaattcaccaaagagataaaaggtctgaaggttgaagtgactcattgtggaacaatgagacggaaataccgtgtttgtaatgtaacaagaaggcctgccagtcatcaaacctttcctttacagttagaaaatggccaaactgtggagagaacagtagcacaatatttcagagaaaagtatactcttcagctgaagtacccacaccttccctgtctgcaagtggggcaggagcagaaacatacgtatctgccactagaagtctgtaatattgtggcagggcaacgatgtatcaagaagctaaccgacaatcagacttccactatgatcaaagcaacagcaagatctgcaccagatagacaagaggaaattagcagattggtaagaagtgcaaattatgaaacagatccatttgttcaggagtttcaatttaaagttcgggatgaaatggcccatgtaaccggacgcgtacttccagcacctatgctccagtatggaggacggaatcgtacagtagcaacaccaagccatggagtatgggacatgcgaggaaaacagttccacacaggagttgaaatcaaaatgtgggctatagcttgttttgccacacagaggcagtgcagagaagaaatattgaagggtttcacggaccagctgcgtaagatttctaaagatgcggggatgcccatccagggccagccttgcttctgcaaatatgcgcagggggcagacagcgtggagcccatgttccggcatctcaagaacacatactctgggctgcagctcattattgtcatcctgccagggaagacgcccgtgtatgcggaggtgaaacgtgtaggagatacacttttgggtatggctacacagtgtgttcaagtcaagaatgtaataaaaacatcccctcaaactctctcaaacctgtgcctaaagataaatgttaaactcggagggatcaataatattcttgtacctcatcaaagaccatctgtgttccagcaaccagtgatctttttgggagcagatgtcactcatccaccagctggtgatgggaagaagccttctattgctgctgttgtaggtagtatggacgcccacccaagcagatactgtgccacagtaagagttcagagaccccgacaggagatcatccaggacttggcctccatggtccgagaacttctcattcaattttataagtcaactcggttcaaacctactcgtatcatcttttatcgggatggtgtttcagagggacagtttcggcaggtgttatattatgaactactagcaattcgagaagcctgcatcagtttggagaaagattatcaacctggaataacttacattgtagttcagaagagacatcacactcgattattttgtgctgacaggacagaaagggttggaaggagtggcaatatcccagctggaacaacagttgatacagacattacacacccatatgagtttgatttttacctctgtagccatgctggaatacagggtaccagccgtccttcacactatcatgttttatgggatgataactgctttaatgcagatgaacttcagctgctaacttaccagctctgccacacttatgtgcgctgtacacgatctgtttctatacctgcaccagcgtattatgctcacctggtggcattcagagccagatatcatctcgtagacaaagaacatgacagtgctgaaggaagtcacgtttcaggacagagcaatgggcgagatccacaagctcttgccaaggctgtacagattcaccaagataccttacgcacaatgtactttgcttaaaaagtccaagattattctctgagaggaagaactgaaagatgaatcgacatacaacgtgtttccagtggagttcgttgagtggggatgcctgcagccatacagaaaccaacactgtggggaccagggtctgatttttatgttgatacaagtaagattgtttacttcatcaaggaacacagcactattatgcaatatgaaaccagccaacagcgcttttgtgcggtctcctgtaggaagtatcgccaatgttttgttttcactttctttgtagtctaacccttttaatgcctttacctcaagttgcttggcagcacaactatctttgcaaaaaaaaaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]