LOCUS       NM_127454                531 bp    mRNA    linear   PLN 20-OCT-2022
DEFINITION  Arabidopsis thaliana uncharacterized protein (AT2G18970), mRNA.
ACCESSION   NM_127454
VERSION     NM_127454.2
DBLINK      BioProject: PRJNA116
            BioSample: SAMN03081427
KEYWORDS    RefSeq.
SOURCE      Arabidopsis thaliana (thale cress)
  ORGANISM  Arabidopsis thaliana
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
            Spermatophyta; Magnoliopsida; eudicotyledons; Gunneridae;
            Pentapetalae; rosids; malvids; Brassicales; Brassicaceae;
            Camelineae; Arabidopsis.
REFERENCE   1  (bases 1 to 531)
  AUTHORS   Lin,X., Kaul,S., Rounsley,S., Shea,T.P., Benito,M.I., Town,C.D.,
            Fujii,C.Y., Mason,T., Bowman,C.L., Barnstead,M., Feldblyum,T.V.,
            Buell,C.R., Ketchum,K.A., Lee,J., Ronning,C.M., Koo,H.L.,
            Moffat,K.S., Cronin,L.A., Shen,M., Pai,G., Van Aken,S., Umayam,L.,
            Tallon,L.J., Gill,J.E., Adams,M.D., Carrera,A.J., Creasy,T.H.,
            Goodman,H.M., Somerville,C.R., Copenhaver,G.P., Preuss,D.,
            Nierman,W.C., White,O., Eisen,J.A., Salzberg,S.L., Fraser,C.M. and
            Venter,J.C.
  TITLE     Sequence and analysis of chromosome 2 of the plant Arabidopsis
            thaliana
  JOURNAL   Nature 402 (6763), 761-768 (1999)
   PUBMED   10617197
REFERENCE   2  (bases 1 to 531)
  CONSRTM   NCBI Genome Project
  TITLE     Direct Submission
  JOURNAL   Submitted (19-OCT-2022) National Center for Biotechnology
            Information, NIH, Bethesda, MD 20894, USA
REFERENCE   3  (bases 1 to 531)
  AUTHORS   Krishnakumar,V., Cheng,C.-Y., Chan,A.P., Schobel,S., Kim,M.,
            Ferlanti,E.S., Belyaeva,I., Rosen,B.D., Micklem,G., Miller,J.R.,
            Vaughn,M. and Town,C.D.
  TITLE     Direct Submission
  JOURNAL   Submitted (17-MAY-2016) Plant Genomics, J. Craig Venter Institute,
            9704 Medical Center Dr, Rockville, MD 20850, USA
  REMARK    Protein update by submitter
REFERENCE   4  (bases 1 to 531)
  AUTHORS   Swarbreck,D., Lamesch,P., Wilks,C. and Huala,E.
  CONSRTM   TAIR
  TITLE     Direct Submission
  JOURNAL   Submitted (18-FEB-2011) Department of Plant Biology, Carnegie
            Institution, 260 Panama Street, Stanford, CA, USA
COMMENT     REVIEWED REFSEQ: This record has been curated by TAIR and Araport.
            This record is derived from an annotated genomic sequence
            (NC_003071).
            
            On May 13, 2003 this sequence version replaced NM_127454.1.
FEATURES             Location/Qualifiers
     source          1..531
                     /organism="Arabidopsis thaliana"
                     /mol_type="mRNA"
                     /db_xref="taxon:3702"
                     /chromosome="2"
                     /ecotype="Columbia"
     gene            1..531
                     /locus_tag="AT2G18970"
                     /gene_synonym="F19F24.17; F19F24_17"
                     /db_xref="Araport:AT2G18970"
                     /db_xref="GeneID:816414"
                     /db_xref="TAIR:AT2G18970"
     CDS             258..446
                     /locus_tag="AT2G18970"
                     /gene_synonym="F19F24.17; F19F24_17"
                     /inference="Similar to RNA sequence,
                     EST:INSD:AI099518.1,INSD:T76844.1"
                     /inference="similar to RNA sequence,
                     mRNA:INSD:BT023472.1,INSD:BT021971.1"
                     /note="unknown protein; Has 3 Blast hits to 3 proteins in
                     1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi -
                     0; Plants - 3; Viruses - 0; Other Eukaryotes - 0 (source:
                     NCBI BLink)."
                     /codon_start=1
                     /product="uncharacterized protein"
                     /protein_id="NP_179487.1"
                     /db_xref="Araport:AT2G18970"
                     /db_xref="GeneID:816414"
                     /db_xref="TAIR:AT2G18970"
                     /translation="

MRKPCLLHVSRVLVWLERKDSLSLVYNLPLHVKFVCFVGTLTGRYLYRAKTHEREKEKEMVW"

ORIGIN      

tccaatctcactcaaaatctcctccatgttcatctcttctccacctggcaaaagcttctgcaattccttcaatctcttcttgatctctcctccttcttcttcttcgtcgctgtcttggtgtttttctccaccttgtctcttgctcgatctttctagaatctcggaaggagaactactagtgctaattggatcatcataaggggaagataatagcttctgttgcaagaaacggctccacgcgaattcttgagcagacaatgcgaaagccatgtctacttcatgtttcacgggttcttgtttggttggagagaaaagactcgctttctcttgtttataatttgcctctccatgtgaaatttgtttgcttcgtcggaactctaacagggagatacttatatagagcaaaaactcacgagagagagaaagagaaagagatggtttggtaatgtatgtgaaaggagtaatgatatatatattaactcatgtgatatttgacacgatcgatcacactttatgaagttatttcttttg

//